ID: 956660093

View in Genome Browser
Species Human (GRCh38)
Location 3:71588861-71588883
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956660093_956660097 10 Left 956660093 3:71588861-71588883 CCAGCCAAGTCTCACACACATTC No data
Right 956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG No data
956660093_956660098 26 Left 956660093 3:71588861-71588883 CCAGCCAAGTCTCACACACATTC No data
Right 956660098 3:71588910-71588932 CATGTGGCCCCTTATACAACAGG No data
956660093_956660096 -9 Left 956660093 3:71588861-71588883 CCAGCCAAGTCTCACACACATTC No data
Right 956660096 3:71588875-71588897 CACACATTCAAGTTGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956660093 Original CRISPR GAATGTGTGTGAGACTTGGC TGG (reversed) Intergenic
No off target data available for this crispr