ID: 956660094

View in Genome Browser
Species Human (GRCh38)
Location 3:71588865-71588887
Sequence ACTTGAATGTGTGTGAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956660094_956660098 22 Left 956660094 3:71588865-71588887 CCAAGTCTCACACACATTCAAGT No data
Right 956660098 3:71588910-71588932 CATGTGGCCCCTTATACAACAGG No data
956660094_956660097 6 Left 956660094 3:71588865-71588887 CCAAGTCTCACACACATTCAAGT No data
Right 956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956660094 Original CRISPR ACTTGAATGTGTGTGAGACT TGG (reversed) Intergenic
No off target data available for this crispr