ID: 956660097

View in Genome Browser
Species Human (GRCh38)
Location 3:71588894-71588916
Sequence AAGGTGATCTATAGTACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956660093_956660097 10 Left 956660093 3:71588861-71588883 CCAGCCAAGTCTCACACACATTC No data
Right 956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG No data
956660092_956660097 11 Left 956660092 3:71588860-71588882 CCCAGCCAAGTCTCACACACATT No data
Right 956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG No data
956660094_956660097 6 Left 956660094 3:71588865-71588887 CCAAGTCTCACACACATTCAAGT No data
Right 956660097 3:71588894-71588916 AAGGTGATCTATAGTACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956660097 Original CRISPR AAGGTGATCTATAGTACATG TGG Intergenic
No off target data available for this crispr