ID: 956661140

View in Genome Browser
Species Human (GRCh38)
Location 3:71599099-71599121
Sequence GGCTTCTGCTAAAATGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956661140_956661145 16 Left 956661140 3:71599099-71599121 CCATTGGCATTTTAGCAGAAGCC No data
Right 956661145 3:71599138-71599160 GAAAGATTGTGTGGTCTGGATGG No data
956661140_956661144 12 Left 956661140 3:71599099-71599121 CCATTGGCATTTTAGCAGAAGCC No data
Right 956661144 3:71599134-71599156 TCAAGAAAGATTGTGTGGTCTGG No data
956661140_956661143 7 Left 956661140 3:71599099-71599121 CCATTGGCATTTTAGCAGAAGCC No data
Right 956661143 3:71599129-71599151 TCATGTCAAGAAAGATTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956661140 Original CRISPR GGCTTCTGCTAAAATGCCAA TGG (reversed) Intergenic
No off target data available for this crispr