ID: 956661142

View in Genome Browser
Species Human (GRCh38)
Location 3:71599120-71599142
Sequence CTTTCTTGACATGATATCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956661142_956661145 -5 Left 956661142 3:71599120-71599142 CCTCGGATATCATGTCAAGAAAG No data
Right 956661145 3:71599138-71599160 GAAAGATTGTGTGGTCTGGATGG No data
956661142_956661144 -9 Left 956661142 3:71599120-71599142 CCTCGGATATCATGTCAAGAAAG No data
Right 956661144 3:71599134-71599156 TCAAGAAAGATTGTGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956661142 Original CRISPR CTTTCTTGACATGATATCCG AGG (reversed) Intergenic
No off target data available for this crispr