ID: 956661144

View in Genome Browser
Species Human (GRCh38)
Location 3:71599134-71599156
Sequence TCAAGAAAGATTGTGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956661140_956661144 12 Left 956661140 3:71599099-71599121 CCATTGGCATTTTAGCAGAAGCC No data
Right 956661144 3:71599134-71599156 TCAAGAAAGATTGTGTGGTCTGG No data
956661139_956661144 18 Left 956661139 3:71599093-71599115 CCAACTCCATTGGCATTTTAGCA No data
Right 956661144 3:71599134-71599156 TCAAGAAAGATTGTGTGGTCTGG No data
956661142_956661144 -9 Left 956661142 3:71599120-71599142 CCTCGGATATCATGTCAAGAAAG No data
Right 956661144 3:71599134-71599156 TCAAGAAAGATTGTGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956661144 Original CRISPR TCAAGAAAGATTGTGTGGTC TGG Intergenic
No off target data available for this crispr