ID: 956663110

View in Genome Browser
Species Human (GRCh38)
Location 3:71618483-71618505
Sequence CTCTAGTCACAGATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956663110_956663114 0 Left 956663110 3:71618483-71618505 CCATGATCCATCTGTGACTAGAG No data
Right 956663114 3:71618506-71618528 GGCCACTTCCTTTCCCTCAAAGG No data
956663110_956663120 30 Left 956663110 3:71618483-71618505 CCATGATCCATCTGTGACTAGAG No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data
956663110_956663117 9 Left 956663110 3:71618483-71618505 CCATGATCCATCTGTGACTAGAG No data
Right 956663117 3:71618515-71618537 CTTTCCCTCAAAGGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956663110 Original CRISPR CTCTAGTCACAGATGGATCA TGG (reversed) Intergenic
No off target data available for this crispr