ID: 956663114

View in Genome Browser
Species Human (GRCh38)
Location 3:71618506-71618528
Sequence GGCCACTTCCTTTCCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956663113_956663114 -7 Left 956663113 3:71618490-71618512 CCATCTGTGACTAGAGGGCCACT No data
Right 956663114 3:71618506-71618528 GGCCACTTCCTTTCCCTCAAAGG No data
956663109_956663114 10 Left 956663109 3:71618473-71618495 CCACTGCTCGCCATGATCCATCT No data
Right 956663114 3:71618506-71618528 GGCCACTTCCTTTCCCTCAAAGG No data
956663108_956663114 20 Left 956663108 3:71618463-71618485 CCTTCGGGAACCACTGCTCGCCA No data
Right 956663114 3:71618506-71618528 GGCCACTTCCTTTCCCTCAAAGG No data
956663110_956663114 0 Left 956663110 3:71618483-71618505 CCATGATCCATCTGTGACTAGAG No data
Right 956663114 3:71618506-71618528 GGCCACTTCCTTTCCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956663114 Original CRISPR GGCCACTTCCTTTCCCTCAA AGG Intergenic
No off target data available for this crispr