ID: 956663117

View in Genome Browser
Species Human (GRCh38)
Location 3:71618515-71618537
Sequence CTTTCCCTCAAAGGTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956663108_956663117 29 Left 956663108 3:71618463-71618485 CCTTCGGGAACCACTGCTCGCCA No data
Right 956663117 3:71618515-71618537 CTTTCCCTCAAAGGTAAAAGTGG No data
956663109_956663117 19 Left 956663109 3:71618473-71618495 CCACTGCTCGCCATGATCCATCT No data
Right 956663117 3:71618515-71618537 CTTTCCCTCAAAGGTAAAAGTGG No data
956663113_956663117 2 Left 956663113 3:71618490-71618512 CCATCTGTGACTAGAGGGCCACT No data
Right 956663117 3:71618515-71618537 CTTTCCCTCAAAGGTAAAAGTGG No data
956663110_956663117 9 Left 956663110 3:71618483-71618505 CCATGATCCATCTGTGACTAGAG No data
Right 956663117 3:71618515-71618537 CTTTCCCTCAAAGGTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956663117 Original CRISPR CTTTCCCTCAAAGGTAAAAG TGG Intergenic
No off target data available for this crispr