ID: 956663120

View in Genome Browser
Species Human (GRCh38)
Location 3:71618536-71618558
Sequence GGAGATCATTATCACAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956663110_956663120 30 Left 956663110 3:71618483-71618505 CCATGATCCATCTGTGACTAGAG No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data
956663118_956663120 -6 Left 956663118 3:71618519-71618541 CCCTCAAAGGTAAAAGTGGAGAT No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data
956663113_956663120 23 Left 956663113 3:71618490-71618512 CCATCTGTGACTAGAGGGCCACT No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data
956663115_956663120 5 Left 956663115 3:71618508-71618530 CCACTTCCTTTCCCTCAAAGGTA No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data
956663116_956663120 -1 Left 956663116 3:71618514-71618536 CCTTTCCCTCAAAGGTAAAAGTG No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data
956663119_956663120 -7 Left 956663119 3:71618520-71618542 CCTCAAAGGTAAAAGTGGAGATC No data
Right 956663120 3:71618536-71618558 GGAGATCATTATCACAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956663120 Original CRISPR GGAGATCATTATCACAAAGC AGG Intergenic
No off target data available for this crispr