ID: 956663720

View in Genome Browser
Species Human (GRCh38)
Location 3:71622918-71622940
Sequence ATGGAGGCAGAGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956663713_956663720 0 Left 956663713 3:71622895-71622917 CCCAGGGAAAAGGCCATGTGAGG No data
Right 956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG No data
956663715_956663720 -1 Left 956663715 3:71622896-71622918 CCAGGGAAAAGGCCATGTGAGGA No data
Right 956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956663720 Original CRISPR ATGGAGGCAGAGATGGAGCC AGG Intergenic
No off target data available for this crispr