ID: 956664010

View in Genome Browser
Species Human (GRCh38)
Location 3:71625031-71625053
Sequence CACTCCAGCCTCCCCGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956664010_956664013 9 Left 956664010 3:71625031-71625053 CCCAGGACGGGGAGGCTGGAGTG No data
Right 956664013 3:71625063-71625085 CATGCCACTGTACTCTAGCCGGG 0: 215
1: 5128
2: 43532
3: 114099
4: 195465
956664010_956664012 8 Left 956664010 3:71625031-71625053 CCCAGGACGGGGAGGCTGGAGTG No data
Right 956664012 3:71625062-71625084 TCATGCCACTGTACTCTAGCCGG No data
956664010_956664014 10 Left 956664010 3:71625031-71625053 CCCAGGACGGGGAGGCTGGAGTG No data
Right 956664014 3:71625064-71625086 ATGCCACTGTACTCTAGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956664010 Original CRISPR CACTCCAGCCTCCCCGTCCT GGG (reversed) Intergenic
No off target data available for this crispr