ID: 956668252

View in Genome Browser
Species Human (GRCh38)
Location 3:71662167-71662189
Sequence TACTGTAAGGGCAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956668246_956668252 -2 Left 956668246 3:71662146-71662168 CCAAGGAAGGAGATTACTTCATA No data
Right 956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG No data
956668243_956668252 7 Left 956668243 3:71662137-71662159 CCTCCACCTCCAAGGAAGGAGAT No data
Right 956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG No data
956668245_956668252 1 Left 956668245 3:71662143-71662165 CCTCCAAGGAAGGAGATTACTTC No data
Right 956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG No data
956668244_956668252 4 Left 956668244 3:71662140-71662162 CCACCTCCAAGGAAGGAGATTAC No data
Right 956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG No data
956668240_956668252 20 Left 956668240 3:71662124-71662146 CCACAAACACTGGCCTCCACCTC No data
Right 956668252 3:71662167-71662189 TACTGTAAGGGCAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956668252 Original CRISPR TACTGTAAGGGCAAGGTGGA GGG Intergenic
No off target data available for this crispr