ID: 956670213

View in Genome Browser
Species Human (GRCh38)
Location 3:71682119-71682141
Sequence CACAGGCACTTGCCTACATT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956670213_956670219 2 Left 956670213 3:71682119-71682141 CCCAATGTAGGCAAGTGCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 956670219 3:71682144-71682166 ATAACAATTTAGGGAATAATGGG 0: 1
1: 0
2: 2
3: 24
4: 283
956670213_956670218 1 Left 956670213 3:71682119-71682141 CCCAATGTAGGCAAGTGCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 956670218 3:71682143-71682165 TATAACAATTTAGGGAATAATGG 0: 1
1: 0
2: 2
3: 27
4: 317
956670213_956670216 -7 Left 956670213 3:71682119-71682141 CCCAATGTAGGCAAGTGCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 956670216 3:71682135-71682157 GCCTGTGATATAACAATTTAGGG 0: 1
1: 0
2: 0
3: 12
4: 247
956670213_956670215 -8 Left 956670213 3:71682119-71682141 CCCAATGTAGGCAAGTGCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 956670215 3:71682134-71682156 TGCCTGTGATATAACAATTTAGG 0: 1
1: 0
2: 0
3: 41
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956670213 Original CRISPR CACAGGCACTTGCCTACATT GGG (reversed) Exonic
900997842 1:6131958-6131980 CACAGCCACTTACCTAAATCAGG + Intronic
901227603 1:7623216-7623238 ACCAGGGACTGGCCTACATTTGG - Intronic
901668879 1:10842530-10842552 CACCAGGATTTGCCTACATTTGG - Intergenic
902225921 1:14996447-14996469 CACAGGGCCTGGCCTACAGTGGG + Intronic
902252162 1:15161066-15161088 CACAGGCAGTTGCCTCCACCAGG - Intronic
909442168 1:75709208-75709230 CTGAGGGACTTGCATACATTTGG - Intergenic
910804078 1:91173267-91173289 GGCAGGCACTGGCTTACATTTGG + Intergenic
915466620 1:156102161-156102183 CACAGGCACATTCCTCCCTTTGG - Intronic
918590491 1:186235738-186235760 CACAGTCACATGCATACATACGG + Intergenic
919883091 1:201913740-201913762 CACAGGCAGCAGCCTCCATTTGG - Intronic
920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG + Intronic
922355142 1:224768296-224768318 CACACACAGTTGCCTTCATTTGG + Intergenic
1062968369 10:1627280-1627302 CACGGACACTTGACTCCATTCGG + Intronic
1064264441 10:13813609-13813631 CACTGCCACTGGCCTACAGTTGG + Intronic
1067817364 10:49491479-49491501 CACAGACACTTGCATACATATGG - Intronic
1068259486 10:54560515-54560537 TAAAGGCAGTTGCCTAGATTTGG + Intronic
1068583018 10:58764179-58764201 AATAGCCAGTTGCCTACATTAGG + Intronic
1069327143 10:67245158-67245180 GCCAGGCACATCCCTACATTAGG + Intronic
1069511061 10:69042809-69042831 CACAGGCACTTACTAGCATTGGG - Intergenic
1072052024 10:91714414-91714436 CACAGGCACTTGTCTCCTTCTGG - Intergenic
1072644923 10:97246320-97246342 CCCAGGCTCCTGCTTACATTCGG - Exonic
1073072183 10:100801677-100801699 CACAGGCTGTAGCCTCCATTTGG + Intronic
1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG + Intergenic
1076299828 10:129416700-129416722 CACAGCCACTAGCATTCATTAGG + Intergenic
1080752429 11:35163306-35163328 CACACTCACTTGCTTGCATTCGG + Intronic
1081813259 11:45924850-45924872 CACAGGCCCTGGCCTGCCTTGGG + Exonic
1082647378 11:55744803-55744825 CACAGATACTTGCCTTAATTAGG - Intergenic
1082781175 11:57288645-57288667 CACTGGCATTAGCCTACAGTTGG - Intergenic
1087562012 11:99802583-99802605 AACAGTCACTTTCCTAGATTAGG - Intronic
1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG + Intronic
1093664881 12:21800182-21800204 CACAGGCAAGTGACTTCATTTGG - Exonic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1099198058 12:79642347-79642369 ATCAAGCACATGCCTACATTAGG + Intronic
1102053100 12:109877605-109877627 CCATGGCACTTGCCAACATTTGG - Intronic
1105820888 13:24079741-24079763 TACAGCCTCCTGCCTACATTAGG + Intronic
1106103997 13:26718146-26718168 CACAGGGACTGGCCCACACTGGG - Intergenic
1107445950 13:40470555-40470577 CACAGTCACCTGCCTTCCTTGGG - Intergenic
1115286484 14:31719070-31719092 CACATACATTAGCCTACATTTGG + Intronic
1115759984 14:36570360-36570382 CACAGGCTCTTGGTGACATTTGG - Intergenic
1125520785 15:40346850-40346872 CAGAGGCACCTGCCAACACTAGG + Intergenic
1127728829 15:61779281-61779303 CACAGGAAAGTTCCTACATTAGG - Intergenic
1127950591 15:63801726-63801748 CACTTGCACTTGCTCACATTAGG - Intronic
1129288188 15:74541909-74541931 CAATGCCACCTGCCTACATTTGG - Intronic
1129738972 15:77980682-77980704 CACAAGCTCTTTCCTCCATTTGG - Intergenic
1130748936 15:86688537-86688559 CACACTCACTTGCGTATATTCGG - Intronic
1132060929 15:98691942-98691964 AACAGGCACTCTCCTACTTTTGG - Intronic
1135292976 16:21256104-21256126 CACTTACATTTGCCTACATTTGG - Intronic
1138790258 16:59895528-59895550 CACTTACACTTGCCTACACTGGG + Intergenic
1141453152 16:84119221-84119243 CACAGGCACTAGCCAACCCTGGG + Intergenic
1141843580 16:86591284-86591306 CACAGGCCTTTGCCCACATAGGG + Intergenic
1144790724 17:17857349-17857371 CACAGGCACTGGGCTACAGAGGG + Intronic
1146974285 17:37097773-37097795 CACACACACTTGCCCACATGTGG + Intronic
1147352357 17:39859848-39859870 CACAGAAACTTGCCTATAGTAGG - Intronic
1152058804 17:78053037-78053059 CAGAGCCACTTGCCTTCATAAGG + Intronic
1152165996 17:78706705-78706727 CACTAGCACTTGCCAACATGAGG + Intronic
1152526212 17:80889650-80889672 CACACGCACTGGCCTTCTTTAGG - Intronic
1156260363 18:35440334-35440356 CACAGGCTGTTGCCTCCACTGGG + Intergenic
1158871994 18:61697075-61697097 CAGAGTCACTTGTCTACATAGGG - Intergenic
1159762651 18:72448062-72448084 TACAGGCACATGCCCACATTCGG + Intergenic
1160106461 18:75982781-75982803 CACAGGGAGTTGCCTTGATTGGG - Intergenic
1163249674 19:16119045-16119067 CAAAGGCACTTGCCTGGTTTGGG - Intronic
1163941899 19:20502888-20502910 CACAGGATCTTGCTTACAATAGG - Intergenic
1164853324 19:31502196-31502218 CCCAAGCCCTTTCCTACATTTGG + Intergenic
1165951260 19:39474994-39475016 CACATGCAGTTCCCTCCATTTGG - Intronic
1166112902 19:40634002-40634024 CCCAGGCCCTTGCCTTCATGGGG + Intergenic
1168645782 19:58058398-58058420 CACAGACACTTGCAAAGATTTGG - Intergenic
931258866 2:60599336-60599358 CACAGGCACCTGCCTGCACCTGG - Intergenic
938687129 2:133749557-133749579 CACAGAGTCTTGTCTACATTAGG + Intergenic
940271772 2:151898884-151898906 CTCAGGCCCTTGCCTTCATCTGG - Intronic
942557276 2:177184859-177184881 TACAGGCACTTGCCACCATGTGG + Intergenic
943432170 2:187817402-187817424 CACAGTGGCTTGCCCACATTGGG - Intergenic
944579839 2:201122777-201122799 CTCAAGCATTTGCCTCCATTTGG - Intronic
944985160 2:205167905-205167927 CTCAAGGACTAGCCTACATTAGG + Intronic
947223650 2:227819510-227819532 CACAAGCACATGGCTAGATTAGG + Intergenic
948646276 2:239407063-239407085 CACATGCATTAGCCTACAGTGGG + Intergenic
1173898640 20:46570497-46570519 CACTGACATTAGCCTACATTTGG + Intronic
1182013028 22:27016404-27016426 CACAGGCAGCTGCCTACTTGGGG - Intergenic
1182044156 22:27261291-27261313 CCAAGTCACTTGCCTACTTTGGG + Intergenic
1182973979 22:34605200-34605222 CACAGCCACATGGCTACAGTTGG - Intergenic
950041733 3:9924049-9924071 CACAGGCATCGGCCTACAGTGGG - Intronic
954616008 3:51968834-51968856 CACAAGCACTTGCACACATGTGG - Exonic
955117427 3:56019520-56019542 AACAGCCACTTGACAACATTTGG - Intronic
956082360 3:65571148-65571170 CAAATGCACCTGCCTGCATTAGG + Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
958963668 3:100535081-100535103 CACAGGCACTTGCTAAAATCAGG + Intronic
960814864 3:121661996-121662018 TACAGGCACTTTTCTGCATTAGG + Intergenic
961861042 3:129916920-129916942 CACACACACTTGCCACCATTTGG - Intergenic
962194415 3:133348597-133348619 CACAGGCCCTTGTCTCAATTTGG - Intronic
964896787 3:161607253-161607275 CACAGGCATTGGGCTAGATTTGG - Intergenic
967139672 3:186545211-186545233 CACAGTCACTTTTCTACATACGG - Intronic
977334595 4:95680590-95680612 CACAGGAACTTGCCTGTAGTTGG + Intergenic
978682005 4:111392654-111392676 CACATGCTATTGACTACATTTGG - Intergenic
987190738 5:15475336-15475358 AACAGGCACTTGCCAATATTTGG - Intergenic
989544246 5:42654354-42654376 GACATGCATTTGCCTACATGGGG - Intronic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
995548943 5:113261190-113261212 CACTTGCACTAGCCTACAGTTGG + Intronic
999079012 5:148826244-148826266 CACCGGCACTGCCCCACATTCGG - Exonic
999267710 5:150277651-150277673 AAAATGCACTTGCTTACATTGGG - Intronic
1001774229 5:174316549-174316571 CCCAGGGCCTGGCCTACATTTGG + Intergenic
1001784467 5:174400292-174400314 TACATGAACTTGCCTACACTAGG - Intergenic
1006621307 6:35366481-35366503 CACAGGCAGAGGCCTAGATTAGG + Intronic
1008870423 6:56266324-56266346 CACAGGTACCAGCCTAGATTTGG - Intronic
1008885130 6:56424174-56424196 CTCAGGCCCTTTCCTACTTTTGG + Intergenic
1010124904 6:72420493-72420515 AACAGGCACTTGCCAAGACTGGG + Intergenic
1011971827 6:93234940-93234962 CACAGCCACTGACCTAAATTAGG - Intergenic
1012535273 6:100288696-100288718 CAGAGGCCTTTGCCTACTTTAGG + Intergenic
1013684265 6:112560904-112560926 CACAGGCATTGGCCTGCACTAGG - Intergenic
1015395046 6:132724225-132724247 CACATCCACTTGGCTACACTGGG + Intronic
1018799538 6:167211215-167211237 CACAGGCGCTTGCCTTCCTGGGG + Intergenic
1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG + Intergenic
1020703637 7:11514042-11514064 CACTGGTTCTTGCCTCCATTTGG + Intronic
1020884142 7:13801828-13801850 AACAGGCAGTTGGCCACATTTGG - Intergenic
1023212747 7:37825483-37825505 CACAGGCACCTCCATACATCTGG + Intronic
1030299346 7:107959768-107959790 CACTGGCACTGGCCTCCGTTGGG + Exonic
1030735370 7:113041805-113041827 CAGTGGCACTTGCCTCCCTTAGG - Intergenic
1030982832 7:116206911-116206933 ACCAGGCACTTGCCAACATCTGG - Intergenic
1036564486 8:9926713-9926735 CACAGGCACATGGTTACATAGGG - Intergenic
1041085437 8:54252156-54252178 CTCAGGCACATGCTTAGATTGGG + Intergenic
1046399347 8:113684427-113684449 CACAGGCACTTGCCTCAAAAAGG + Intergenic
1046879173 8:119289702-119289724 GAGAGGCACTCGCCTACATGGGG + Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1055982710 9:82020956-82020978 CACTGACATTAGCCTACATTTGG - Intergenic
1060495301 9:124113829-124113851 CACATGCAGTTGCATACACTGGG - Intergenic
1061367620 9:130180820-130180842 CACAGGCTCTTGGCTGAATTGGG + Intronic
1203788021 EBV:138653-138675 GGCACGCAATTGCCTACATTAGG - Intergenic
1186423115 X:9442728-9442750 CACAGGGATTTGGCTACTTTGGG - Intergenic
1189722455 X:43934115-43934137 CACTGGCAGTGCCCTACATTAGG - Intergenic
1189766525 X:44377919-44377941 CATAGGCACTTGCCACCTTTTGG - Intergenic
1191054849 X:56231462-56231484 CTCAGGGACTTGCCCATATTAGG + Intergenic
1198102338 X:133432827-133432849 CAGAGGGACTCGCCCACATTAGG + Intergenic
1201698341 Y:16852680-16852702 CACAGGCTTTTGTCTAAATTTGG + Intergenic