ID: 956675173

View in Genome Browser
Species Human (GRCh38)
Location 3:71725687-71725709
Sequence CCGGTCCCTCTCACCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956675173_956675186 24 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675186 3:71725734-71725756 CAGCCATGCAAAAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 30
4: 222
956675173_956675183 16 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675183 3:71725726-71725748 TGGCTCTGCAGCCATGCAAAAGG 0: 1
1: 0
2: 0
3: 30
4: 221
956675173_956675188 28 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675188 3:71725738-71725760 CATGCAAAAGGGCAGCGGGATGG 0: 1
1: 0
2: 1
3: 15
4: 169
956675173_956675179 -9 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675179 3:71725701-71725723 AGGGACCGGGGAACGGTCTGCGG 0: 1
1: 0
2: 1
3: 10
4: 146
956675173_956675182 -4 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675182 3:71725706-71725728 CCGGGGAACGGTCTGCGGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 123
956675173_956675184 17 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675184 3:71725727-71725749 GGCTCTGCAGCCATGCAAAAGGG 0: 1
1: 0
2: 2
3: 25
4: 220
956675173_956675180 -8 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675180 3:71725702-71725724 GGGACCGGGGAACGGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 113
956675173_956675185 23 Left 956675173 3:71725687-71725709 CCCACGGGGGTGAGAGGGACCGG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 956675185 3:71725733-71725755 GCAGCCATGCAAAAGGGCAGCGG 0: 1
1: 0
2: 1
3: 21
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956675173 Original CRISPR CCGGTCCCTCTCACCCCCGT GGG (reversed) Intronic
900786444 1:4653429-4653451 CCCGCCCCTCTCACCCCCCACGG + Intergenic
903064342 1:20690335-20690357 CTGGTCCCTCCCACCCCCCCAGG - Exonic
908312717 1:62901483-62901505 CTGGTCCCTATCACCCCCCTGGG + Intergenic
912763260 1:112386880-112386902 CCAGTCCCTCTGACCCTAGTGGG + Intergenic
916344761 1:163775334-163775356 CAGCTCCCTCTGACTCCCGTGGG - Intergenic
916676383 1:167067186-167067208 CCGGTCTCTGTCACCCAGGTGGG + Intronic
922620622 1:226985966-226985988 CCCGTCCCTCTGACCACCTTGGG + Intronic
923676800 1:236087465-236087487 AGGGTCCCTCTCACCCCATTGGG - Intergenic
924944671 1:248838345-248838367 CCTGTCCCTCTCGCCCGCGTCGG - Exonic
1069572069 10:69500287-69500309 CCTGGCCCCCTCACCCCAGTAGG - Intronic
1069795525 10:71049523-71049545 CCGGTTCCTGTCACTCCCTTTGG + Intergenic
1073206256 10:101770937-101770959 CCTGCCCCTCTCACCCCCCCAGG + Intronic
1074298586 10:112212961-112212983 CCCGTCCCTCTCACCTGCCTTGG - Intronic
1098391178 12:69971491-69971513 CCAGTCCCTCTCACCACCCGTGG + Intergenic
1104966049 12:132509270-132509292 GGGGTCCCTCCCAGCCCCGTCGG + Intronic
1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG + Intronic
1106989468 13:35399902-35399924 CCTGTCCCTCTCCCTCCCTTTGG - Intronic
1108211993 13:48148548-48148570 CCAGGCTCTCTCACCCCCTTAGG - Intergenic
1113742670 13:112722267-112722289 CCGGTCCCCCTACCCCCCGCCGG - Intronic
1113815746 13:113169769-113169791 CAGGTCCCTCTCACACTCTTGGG + Intronic
1115089689 14:29559003-29559025 CCAGTCTCTCTCACTCCAGTGGG - Intergenic
1117906729 14:60597009-60597031 CCCTTCCCTCTCACTCCCGTTGG + Intergenic
1119179791 14:72598074-72598096 CCGGTCCCTTCCAGCTCCGTTGG - Intergenic
1121815499 14:96925297-96925319 CCTTGCCCTCTGACCCCCGTAGG - Intronic
1122044216 14:99011923-99011945 CATGCCCCTCTCACCCCCGAGGG + Intergenic
1122836429 14:104433073-104433095 CGGCTCCCTGCCACCCCCGTGGG - Intergenic
1124620356 15:31270466-31270488 CCCTCCCCTCTCACCCCAGTTGG - Intergenic
1128578954 15:68795569-68795591 CAAGTCCCTCTCACACCCGCGGG - Intronic
1130696840 15:86139810-86139832 CTGGGCCCTCTCACCCAGGTGGG - Intergenic
1132544730 16:527949-527971 CCGGGCCCGCTCGCCCCCGCCGG - Exonic
1132745915 16:1436239-1436261 CCCCTCCCTCTACCCCCCGTTGG - Intronic
1132898089 16:2238298-2238320 CCGGCCCCTCCCATCCCTGTGGG + Intronic
1133107784 16:3524757-3524779 CAGGTTCCTCTCATCCCTGTGGG + Intronic
1135151784 16:20013702-20013724 CCGGTCCCTCCCACATACGTGGG - Intergenic
1136078809 16:27838339-27838361 CCTGTTCCTCTCACCCCCCAGGG + Intronic
1136107439 16:28040210-28040232 CAGGTCCCTCTCCCACCCGAGGG + Intronic
1139545368 16:67647379-67647401 CCTGTCCCCCTCACCCCCTCAGG - Exonic
1141813382 16:86391849-86391871 CAGTTCCCACTCACCCCCGTAGG - Intergenic
1142306370 16:89288187-89288209 CCGGTCCCCGTCACCACTGTGGG - Intronic
1146151565 17:30477493-30477515 TCAGCCCCTCTCACCCTCGTAGG - Intronic
1148018718 17:44539884-44539906 AGCGTCCCTCTCAGCCCCGTGGG + Intergenic
1150828811 17:68500245-68500267 CTGGTCCCTCCCACACACGTGGG - Intergenic
1151348031 17:73515292-73515314 CCCGTCCCTCTCACCACCCCTGG - Intronic
1151728413 17:75897269-75897291 CGGGTCCATCCCACCCCCCTGGG + Intergenic
1152015325 17:77746937-77746959 CCCCTCCCTCTCAGCCCCCTGGG + Intergenic
1152417167 17:80170160-80170182 CCGGCCCCTCCCACTCCCCTGGG - Intronic
1152431080 17:80248568-80248590 CCGGCCCCTCTGACACCTGTGGG - Exonic
1152663116 17:81552132-81552154 CCGGTCCCTCCCGCCCCCGCGGG + Intronic
1160900671 19:1426544-1426566 CCTGTCCCTCTCACCTCCGGGGG - Intronic
1161047331 19:2142712-2142734 CCGGTCCCCCTCACCCCAATGGG + Intronic
1162524735 19:11200821-11200843 CCAGTCCCTCTCACCCCACAGGG - Exonic
1166302098 19:41917093-41917115 TCGGTCTCTCTCAGCCCCTTCGG + Intronic
1168461552 19:56563337-56563359 TCTGTCCCTCTCACTCCAGTTGG + Intergenic
925342210 2:3145576-3145598 CCGGGCCCTCCAGCCCCCGTTGG - Intergenic
925866719 2:8234583-8234605 CAGGTCCCTCTGACCACTGTGGG + Intergenic
929962564 2:46507591-46507613 CTTCTCCCTCTCAACCCCGTGGG - Intronic
931602487 2:64018865-64018887 TCGGTCCCTCTCTCCGCTGTAGG + Intronic
932905092 2:75740393-75740415 CGGGTCCCTCCCACAACCGTGGG + Intergenic
933696617 2:85223467-85223489 CCCCTCCCTCTAACCCCCCTTGG - Intronic
939577651 2:143915282-143915304 CCTGACCCTCTCACCCAAGTTGG - Intergenic
1169277382 20:4243080-4243102 CCGGTACCCCTCACACCCGCAGG + Intronic
1175760747 20:61560902-61560924 CCCGTCCCTCTCATCCGGGTTGG - Intronic
1175892768 20:62322786-62322808 CTGGGCCCTCTCACCCCCCCAGG + Intronic
1176141194 20:63545838-63545860 CAGGTCCCTCCCAGCACCGTGGG + Intronic
1176198415 20:63848349-63848371 CCGGTGCCTCCCACACACGTGGG - Intergenic
1179352381 21:40624512-40624534 CAGGTGCCTCTCACCCCACTTGG - Intronic
1180022295 21:45136059-45136081 CTGATCCCTCCCACCCCCATGGG - Intronic
1181459144 22:23076025-23076047 ATGGTCCCTCTCACCCTGGTTGG + Intronic
949105560 3:197340-197362 CGGGTCCCACTCACGCCCGCCGG + Intronic
954304316 3:49717464-49717486 CCACTCCCTCCCACCCCCTTGGG + Exonic
956675173 3:71725687-71725709 CCGGTCCCTCTCACCCCCGTGGG - Intronic
959033181 3:101327286-101327308 CAGGTCCCTCCCACCACAGTGGG - Intronic
961211618 3:125130036-125130058 CCTGTCCCTCTCACTCTCATTGG - Intronic
963857525 3:150270636-150270658 CAGGTCCCTCCCACACACGTGGG - Intergenic
964801601 3:160564942-160564964 CCGGCCCCTCGCACCCGCGCCGG + Intronic
968008749 3:195259840-195259862 CCGGTCCCCGTCACACCCGGCGG - Intronic
968399966 4:285610-285632 CAGTCCCCTCTCACCCCCGGAGG + Intronic
970710256 4:18853530-18853552 CTGTTCCCTATCACCACCGTAGG - Intergenic
974253115 4:59414684-59414706 CAGGTCCCTCCCACACACGTGGG - Intergenic
975778995 4:77819726-77819748 CCGGTGCCTCTCCCCTCCGGCGG - Intergenic
984213723 4:176881770-176881792 CCTGTTCCTCTCACCCACTTTGG + Intergenic
985576827 5:677491-677513 CTGGCTCCTCTCAGCCCCGTGGG - Intronic
987247198 5:16060797-16060819 CAGGTCCCTCCCACACACGTGGG + Intergenic
999286435 5:150396888-150396910 AGGGTCCCTCCCGCCCCCGTGGG - Intronic
1001951133 5:175817460-175817482 TCAGTCCCTCTGACCCCAGTGGG - Intronic
1003099020 6:3163087-3163109 CCGGTGCCTCTCCCGCCCGCAGG - Intergenic
1003243831 6:4367760-4367782 CTGGACTCTCTCACCCCCCTGGG - Intergenic
1006186994 6:32187127-32187149 TCGGTCCCTCTCACCCCAAAAGG + Intronic
1010128065 6:72457536-72457558 CCTGTCCTTCCCACCCCAGTGGG + Intergenic
1017152401 6:151292462-151292484 CAGGACCCTCCCACCCCTGTTGG + Intronic
1019147018 6:169982141-169982163 ACAGTGCCTCCCACCCCCGTGGG + Intergenic
1019189938 6:170245957-170245979 CATCTCCCTTTCACCCCCGTGGG - Intergenic
1019636371 7:2078229-2078251 CGGGACCCTCTCAACCCTGTAGG - Intronic
1022629427 7:32071129-32071151 CCGGGCACACTCACCCCCGCAGG + Intronic
1031356422 7:120792343-120792365 CCGGTCCCTCCCTCCCCAGGAGG + Intronic
1036781169 8:11648810-11648832 ACGTTCCCTCTCTCCCACGTTGG - Intergenic
1038288007 8:26223288-26223310 CTGGTCCCTCTCACTCCCGTGGG - Intergenic
1040073554 8:43206991-43207013 CAGGACCTTCTCACCCCTGTTGG - Intergenic
1045282189 8:100758760-100758782 CCCGTCCCTCCCACCCCAGCTGG + Intergenic
1046880915 8:119307194-119307216 CAGATGCCTCTCACCCCAGTAGG - Intergenic
1048737733 8:137520232-137520254 CAGGTCCCTCTCACCTCTCTGGG + Intergenic
1049637655 8:143697650-143697672 CCGGCCCCTCACACCCCCATGGG - Intronic
1049936184 9:504093-504115 CCGGTCCCCCTCACCCGGGGAGG + Intronic
1050075238 9:1856091-1856113 CCAGTGACTCTCATCCCCGTGGG + Intergenic
1059000012 9:110338864-110338886 CCGGTCCCTCCCACAACCCTTGG - Intergenic
1061237953 9:129352938-129352960 CCGGTCCCTCTCCCCTCCTGGGG + Intergenic
1062594011 9:137289357-137289379 TCGGTCCCTCCCACCCTCGCTGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186517753 X:10179227-10179249 CCGGCCCCTTTCACCCTCGCAGG - Intronic
1196444396 X:115737909-115737931 CCGGACTCTTTCACCCCCATGGG - Intergenic
1200116736 X:153772824-153772846 CCTGGCCCTTTCACCCCCCTGGG - Intronic
1201489373 Y:14524476-14524498 CCGTTCCCTCCCACTCCCCTAGG + Intronic