ID: 956675829

View in Genome Browser
Species Human (GRCh38)
Location 3:71731052-71731074
Sequence GAGTGAGGACTGGGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956675829_956675837 4 Left 956675829 3:71731052-71731074 CCAGCCACTCCCAGTCCTCACTC 0: 1
1: 0
2: 5
3: 46
4: 509
Right 956675837 3:71731079-71731101 GTCAGCCAAGCATGGCCTGGAGG 0: 1
1: 0
2: 4
3: 21
4: 236
956675829_956675834 -4 Left 956675829 3:71731052-71731074 CCAGCCACTCCCAGTCCTCACTC 0: 1
1: 0
2: 5
3: 46
4: 509
Right 956675834 3:71731071-71731093 ACTCCTGAGTCAGCCAAGCATGG 0: 1
1: 0
2: 2
3: 30
4: 221
956675829_956675841 26 Left 956675829 3:71731052-71731074 CCAGCCACTCCCAGTCCTCACTC 0: 1
1: 0
2: 5
3: 46
4: 509
Right 956675841 3:71731101-71731123 GACTGCAACAGCCTCCTAACGGG 0: 2
1: 9
2: 70
3: 219
4: 829
956675829_956675840 25 Left 956675829 3:71731052-71731074 CCAGCCACTCCCAGTCCTCACTC 0: 1
1: 0
2: 5
3: 46
4: 509
Right 956675840 3:71731100-71731122 GGACTGCAACAGCCTCCTAACGG 0: 1
1: 0
2: 1
3: 25
4: 163
956675829_956675836 1 Left 956675829 3:71731052-71731074 CCAGCCACTCCCAGTCCTCACTC 0: 1
1: 0
2: 5
3: 46
4: 509
Right 956675836 3:71731076-71731098 TGAGTCAGCCAAGCATGGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956675829 Original CRISPR GAGTGAGGACTGGGAGTGGC TGG (reversed) Intronic
900568401 1:3346625-3346647 GAGTGAGGGGTGGGCCTGGCTGG - Intronic
900590962 1:3459610-3459632 GAGGGAGGACGGGGGGTGTCTGG + Intronic
900822400 1:4899654-4899676 GAGTGAGGAGGGTGAGTGGCTGG - Intergenic
900883877 1:5401921-5401943 GAGTGAGGACGGGGAGGCGGGGG - Intergenic
900947986 1:5842006-5842028 GAGGAAGGAGTGGGAGTGACAGG - Intergenic
901117287 1:6857280-6857302 GAGTGTGGGCTGGGAGAGACAGG + Intronic
901351723 1:8603055-8603077 GAGAGATGACTGGAAGTGGGAGG + Intronic
901679484 1:10904822-10904844 CAGGGAGGACAGGGCGTGGCAGG - Intergenic
901735030 1:11306801-11306823 CAGTGAGGACAGGGAGTCGGGGG - Intergenic
901769704 1:11524054-11524076 GGGTGAGCACTGGGGGTGGAGGG + Exonic
902651217 1:17838862-17838884 GAGGCGGGACTGGGAGAGGCAGG - Intergenic
902779191 1:18693578-18693600 GAGTGAGGACAGGGGGCGGAGGG - Intronic
903663211 1:24991279-24991301 GAGTGAGGAGGCTGAGTGGCTGG - Intergenic
903926353 1:26833539-26833561 GTGTGAGGAACGGCAGTGGCTGG + Intronic
904325820 1:29727173-29727195 GAGAGAGGCCTGGCAGTGGAGGG + Intergenic
905002901 1:34687193-34687215 GAGTGAGGAATGGAAGGGGCAGG - Intergenic
905172040 1:36115202-36115224 GCCTGAGGCCTGGGGGTGGCTGG - Intronic
905274460 1:36807924-36807946 GGCTGAGGACTAGGAGGGGCTGG - Intronic
905286129 1:36881582-36881604 GAGTCGGGGCTGGGAGTGGCGGG - Intronic
905671264 1:39791796-39791818 GAGTGAGGGCTGGGTGGGGTGGG - Intergenic
905874575 1:41423819-41423841 GAGGGTGGCCTGGGAGGGGCAGG - Intergenic
905945823 1:41900811-41900833 GAGGGAGAAAGGGGAGTGGCCGG + Intronic
907447751 1:54519877-54519899 CAGTCAGGCCTGGGGGTGGCAGG - Intergenic
907612900 1:55890353-55890375 GAGGGAGGACTGTGAATGGAGGG - Intergenic
907626654 1:56036995-56037017 GAGTTAGGACTGTGAATTGCGGG - Intergenic
908097972 1:60760514-60760536 GAGTGAGGTTTGGGAGTAGATGG + Intergenic
908334899 1:63111808-63111830 GATTGAGCAATGAGAGTGGCAGG + Intergenic
911278311 1:95891978-95892000 GTGAGAGGACAGAGAGTGGCAGG - Intergenic
913334684 1:117698362-117698384 GAGGGAGGGCCTGGAGTGGCAGG + Intergenic
914424520 1:147562763-147562785 GAGTGTGGACGGGGGGTGGCAGG + Intronic
915586283 1:156845561-156845583 GAGTGGGGCCTGTGAGGGGCGGG - Intronic
915932296 1:160068268-160068290 GGGTGGGGAGTGGGAGTGGCAGG - Intronic
916397352 1:164405570-164405592 GAGTCAGGACTTGGAGTTGCGGG - Intergenic
917084418 1:171291707-171291729 GCCTGAGGACTGGGGGTGGTAGG + Intergenic
918098574 1:181354362-181354384 GGCTGAGGACAAGGAGTGGCAGG + Intergenic
918128703 1:181606446-181606468 GAGGGAGGACTGGGCGCAGCCGG - Intronic
918597998 1:186315752-186315774 GAGTGAGAACAGAGAGTAGCAGG - Intronic
919663782 1:200273023-200273045 GTGTGAGGACTGGGCCTGCCAGG + Intergenic
919920109 1:202162338-202162360 GACTGAGGCCTAGCAGTGGCTGG + Intergenic
920290103 1:204915972-204915994 GACTGATGACAGGGAGTGTCTGG - Intronic
920306303 1:205020307-205020329 GCGTGGGCACTGGGTGTGGCAGG - Exonic
920527026 1:206674848-206674870 GAGGGAGCCCTGGGAGGGGCAGG + Intronic
920811291 1:209288218-209288240 GGGTGAGGACAGAGGGTGGCAGG + Intergenic
920839176 1:209539486-209539508 GTGTGAGGTAGGGGAGTGGCAGG - Intergenic
920965019 1:210694331-210694353 GAGTGAGGGCCGGGAGTAGCTGG - Intronic
921904954 1:220486456-220486478 GAGTGAGGAGTGACAGTGGGTGG - Intergenic
922534548 1:226370358-226370380 GGGTGAGACCTGGGGGTGGCAGG - Intronic
923644374 1:235801897-235801919 CAGTGAAGACTAGCAGTGGCTGG + Intronic
924471524 1:244346859-244346881 GGGTGAGGACTGGGGAAGGCAGG + Intergenic
924607174 1:245544777-245544799 GAGTCAGGATTGGGAGAGGAAGG + Intronic
924665499 1:246067438-246067460 AAGTGGGGAGTGGGAGTTGCGGG + Intronic
1062795006 10:338561-338583 GACTGCGGACTGGGTGTGTCAGG + Intronic
1063105502 10:2988352-2988374 CCATGTGGACTGGGAGTGGCAGG - Intergenic
1063524689 10:6773739-6773761 GTGTGATGTCTGGGAGAGGCAGG + Intergenic
1064390759 10:14940157-14940179 GAGAGGGGAATGGGAGTGGTAGG - Intronic
1064552653 10:16520051-16520073 GAGTCCGGAATGGGCGTGGCAGG - Intronic
1064776407 10:18782682-18782704 GGGTGAAGACTGGGAGAGGGGGG - Intergenic
1067351921 10:45484300-45484322 GGGTGAGGACTGAGTGTGGATGG + Intronic
1068989102 10:63133190-63133212 GAATGAGGACAGGCAGTGGGTGG - Intergenic
1069258235 10:66361311-66361333 GAGGGAGGAAGGGGAGGGGCGGG - Intronic
1069580058 10:69559677-69559699 GAGTGAGGAGGGGGAGAGGAGGG + Intergenic
1070387132 10:75935733-75935755 GAGTTTGGAGAGGGAGTGGCAGG + Intronic
1071508342 10:86246239-86246261 TAGTGGGGTCAGGGAGTGGCAGG - Intronic
1072744943 10:97933328-97933350 AAGTGTGCACTGGGAGAGGCCGG - Intronic
1073070228 10:100788556-100788578 GAGTGAGGGCTGGGTATGGCTGG + Intronic
1074618254 10:115092666-115092688 CAGCGAGGGCTGGGAGGGGCGGG - Intergenic
1074727251 10:116324546-116324568 GAGAGAGGACTGGGATTGAAAGG + Exonic
1075650818 10:124127647-124127669 GGGTCAGAACTGGGAGTGGAGGG - Intergenic
1075922955 10:126228071-126228093 AAGTGAGGACTGGCAGTGTCTGG - Intronic
1076316423 10:129544964-129544986 AAGTGAGGACTCGGAGGGACTGG + Intronic
1076449286 10:130545128-130545150 GAGTGGGGCTTTGGAGTGGCTGG + Intergenic
1076484560 10:130807766-130807788 GAGTGAAGAATGGGTGTGGATGG + Intergenic
1076520324 10:131077106-131077128 GAGGCAGGACTGGCTGTGGCAGG + Intergenic
1077113684 11:873200-873222 GAGTGAGGACGGGCAGCTGCAGG + Intronic
1077360533 11:2138589-2138611 GAGAGAGGACAGCGAGAGGCGGG + Intronic
1077539900 11:3141582-3141604 CAGAGAGGACAGGGAGGGGCTGG + Intronic
1079130497 11:17744424-17744446 GAGTGAGGACAGGATGAGGCAGG - Intronic
1079805378 11:24924050-24924072 GAGTGGGGGCTGGGTGTGGGGGG - Intronic
1080497460 11:32833872-32833894 GAGTGTGGACAGGGAGTGCCAGG + Intronic
1080823849 11:35831470-35831492 AAGTGAGGACTAGGGCTGGCTGG - Intergenic
1081636287 11:44724457-44724479 TGGTGAGGAGTGGGAGTGGAGGG + Intergenic
1081705954 11:45181911-45181933 GAGGGAGAAGTGGGAGTGGGAGG + Intronic
1081799232 11:45846625-45846647 GAGTAAGGACTGGGAATGTGGGG - Intergenic
1081854732 11:46296199-46296221 GAGGGAGGGCTGGGTGTGGTTGG + Intronic
1082807465 11:57460104-57460126 GCTTGAGGTCTGGGAGTGGAAGG + Intergenic
1083621172 11:64050155-64050177 GAGGGAGAGGTGGGAGTGGCAGG - Intronic
1084209966 11:67616300-67616322 GCCTGAGGACTGGGGCTGGCGGG + Intergenic
1084266914 11:68009890-68009912 GAGGGAAGGCTGGGAGTGGGGGG + Intronic
1084431407 11:69113489-69113511 GAGTTAGAACAGGGAGTTGCCGG - Intergenic
1084665992 11:70576662-70576684 GAGTTAGGCCTGGGAGTGTGGGG - Intronic
1084949619 11:72657469-72657491 GATGGAGGAGTGGGAGGGGCAGG - Intronic
1084965281 11:72741344-72741366 GGGTGAGGACTGGGAGAGTGGGG - Intronic
1085454011 11:76655735-76655757 GACTGTGACCTGGGAGTGGCAGG + Intergenic
1086369283 11:86140646-86140668 GTCTGAGGACTGGGGATGGCTGG - Intergenic
1086944203 11:92828995-92829017 GAGTGAGGAGAGGTAGGGGCTGG - Intronic
1087007441 11:93483510-93483532 GAGAGAGGCCTGGGGGTGGAGGG + Intronic
1089098500 11:115939803-115939825 GCGTGAGGACTGAAAGTGGCAGG + Intergenic
1089492938 11:118895020-118895042 GAGTGTGTTCTGGGAGGGGCAGG - Exonic
1089735896 11:120550103-120550125 GGGTCAGGAGTGGGAGTGGGAGG + Intronic
1089812463 11:121143253-121143275 GAGTGTGGCTTGGGAGTGGTGGG - Intronic
1090396835 11:126424634-126424656 GGACGAGGACTGGGAGTGGTGGG + Exonic
1090433085 11:126663123-126663145 GAGTGTGGAGTGTGAGAGGCAGG + Intronic
1090854647 11:130600947-130600969 GATTGAGGGCTTGGAGTGGGAGG + Intergenic
1090974498 11:131670203-131670225 GAGTGGGTACTGGACGTGGCAGG - Intronic
1091232690 11:133998913-133998935 CAGTGAAGGATGGGAGTGGCAGG + Intergenic
1091399683 12:174487-174509 GAGTGAGGGCTGAGAGTGGGAGG + Intronic
1091681769 12:2532625-2532647 GGGTGAGGAGTGGGAGTGTCGGG - Intronic
1091698467 12:2643792-2643814 GAGAGAGAGCTGGGAATGGCAGG - Intronic
1091917014 12:4277006-4277028 CAGTGAGGAGGGGGAGGGGCGGG - Intronic
1091926690 12:4356923-4356945 GAGTGAGGAGTGGGAAGGACAGG - Intergenic
1092223136 12:6729126-6729148 GATTTAGGAATGGGAGTGGAGGG + Intronic
1092595165 12:9995165-9995187 GAATGAGGTCTGGAAGTGGGAGG - Exonic
1093958670 12:25250536-25250558 GAGTGAGGAATGGGCGGTGCGGG - Intronic
1094780439 12:33786366-33786388 AAGGGAGTACTGGGAGAGGCTGG - Intergenic
1095871491 12:47033251-47033273 CAGTGAGGAATGGAAGTGCCAGG - Intergenic
1095976207 12:47942538-47942560 GAGGGAGGTCTGAGAGAGGCTGG - Intronic
1096220682 12:49826843-49826865 GAGTGAGGACCTGGAGGGGCAGG - Intronic
1096612251 12:52810104-52810126 AAGGGAGGGCTGGGAGGGGCTGG + Intronic
1097318653 12:58201300-58201322 GAGAGAGGAGTGGAGGTGGCGGG + Intergenic
1099281915 12:80660401-80660423 GAGTTAGGACTTGGAAAGGCTGG + Intronic
1100107402 12:91192607-91192629 GAGTGAGAGGTGGGAGTGGCAGG - Intergenic
1101592189 12:106134501-106134523 GAGTCTGGGATGGGAGTGGCAGG - Intronic
1101743617 12:107521221-107521243 GAGTTTGGACTGGCAGTCGCTGG + Intronic
1102236057 12:111295435-111295457 GAGGGAGGACTGGGAGGGGACGG + Intronic
1102303398 12:111787454-111787476 GAGGGAGGACCCTGAGTGGCTGG + Intronic
1102460087 12:113094746-113094768 GACTGAGGACTGGGGAGGGCAGG - Intronic
1103103669 12:118203736-118203758 GATTGAGGACTGGGAAAGGTAGG + Intronic
1103148267 12:118614176-118614198 GAATGAGAACTGGGGGTGGGAGG + Intergenic
1103194096 12:119027067-119027089 GAGTGATGTCTGGGACTGCCTGG + Intronic
1104519421 12:129459200-129459222 GAGTGAGGCCTGGTAATCGCTGG + Intronic
1104612845 12:130243701-130243723 GAGTGGGAGCTGGAAGTGGCAGG - Intergenic
1104906020 12:132213983-132214005 GGTTGAGGACTCGGAGTCGCGGG - Intronic
1105599603 13:21875047-21875069 GAGGGAGGAATGGGGGAGGCCGG - Intergenic
1105886737 13:24649110-24649132 AAGTGAAGATTGGGGGTGGCAGG - Intergenic
1106479228 13:30124225-30124247 GAATGAGACCTGGGAGTGCCAGG - Intergenic
1106799206 13:33239043-33239065 GAATGATGACTGTCAGTGGCTGG - Intronic
1107342569 13:39423967-39423989 AGGTGAGGGATGGGAGTGGCAGG + Intronic
1107423093 13:40267988-40268010 GAGTGTGGACTGGGATATGCTGG + Intergenic
1107569647 13:41643342-41643364 GTGTGATGACTGGCAATGGCTGG - Intronic
1107631962 13:42351482-42351504 GAGAGAAGACCGGGACTGGCAGG + Intergenic
1107862699 13:44675820-44675842 GGGTGATGTCTGTGAGTGGCAGG + Intergenic
1108176514 13:47798218-47798240 GAGGGAAAACTGGGAGGGGCAGG + Intergenic
1108872856 13:55007911-55007933 GAGTGAGCCCTGGTCGTGGCTGG + Intergenic
1109386864 13:61641143-61641165 GAGAAAGGACTGGGAGAGGTTGG + Intergenic
1112326057 13:98443546-98443568 GAGTGGGAACTGGGAGAGGCTGG - Intronic
1112326141 13:98443894-98443916 CAGTGAGGCCAGGGAGTGGCGGG + Intronic
1113007261 13:105721547-105721569 GAGTAGGAACTAGGAGTGGCTGG - Intergenic
1114587440 14:23827202-23827224 GGCTGAGGACTGGGAGTGGCTGG - Intergenic
1114610660 14:24037890-24037912 GATGAAGGACTGGGAGCGGCTGG + Intergenic
1116872811 14:50084006-50084028 GAGTCTGGAGTGGGAGGGGCAGG + Exonic
1118841557 14:69517125-69517147 GAGTGGGGGCTGGGGGTGGGGGG + Intronic
1119756476 14:77123684-77123706 GGGTGAGGACTGGGACAGGCTGG - Intronic
1119890205 14:78176841-78176863 GAGTGAGGTCTTGGTGGGGCAGG + Intergenic
1120036651 14:79705678-79705700 GAGTGAGTACTGTGAATAGCAGG - Intronic
1120328510 14:83057885-83057907 GAATGAGGTCTGAGACTGGCAGG + Intergenic
1121112513 14:91321982-91322004 GAGTCAGGAATGGGAGTTCCTGG + Intronic
1121528555 14:94637354-94637376 AACTGAGGCCTGGGAGTGTCAGG + Intergenic
1121644185 14:95506668-95506690 GAGGGAGAACTTGGAGAGGCTGG + Intergenic
1121686804 14:95841688-95841710 TAGTGAGGAAGGGGAGGGGCTGG + Intergenic
1121779007 14:96609610-96609632 GAGTGAGGGCTGGGGTGGGCTGG - Intergenic
1121780532 14:96619119-96619141 GAGTGAGGACACGGAGGGGCAGG + Intergenic
1122200293 14:100118582-100118604 GAGTGAGCACTGCAAGAGGCGGG - Intronic
1124146673 15:27134336-27134358 TGGTGAGGACAAGGAGTGGCTGG - Intronic
1124348590 15:28939027-28939049 GAGTGGTGGCTGGGAGGGGCTGG - Intronic
1124587806 15:31025649-31025671 GAGTGGGAACTGGGAGGGGTGGG - Intronic
1125554597 15:40573709-40573731 GTGTGCGGCCTGTGAGTGGCCGG - Exonic
1127160414 15:56177889-56177911 AAGTGGTGACTGGGAGTGGAGGG - Intronic
1127672981 15:61213258-61213280 GGGTGAGGGTTGGGAGTGGAAGG - Intronic
1127962319 15:63898968-63898990 GAGGCAGGGCTGGGAGGGGCAGG - Intergenic
1128580593 15:68807234-68807256 GATAAAGGACTGGGAGAGGCTGG + Intronic
1129154792 15:73711036-73711058 GAGTGAGGGCTGGAAGGGGCGGG - Intronic
1129452858 15:75660357-75660379 GAGCCAGGCCTGGGAGAGGCAGG + Exonic
1129609119 15:77038870-77038892 GGGCGAGGGCTGGGAGAGGCGGG + Intergenic
1130012311 15:80161144-80161166 GAGTGGGGAGTGAGAGGGGCTGG - Intronic
1130391512 15:83459940-83459962 GGGTGAGAACTGGGGGTGGGGGG - Intronic
1132100847 15:99021907-99021929 GGCTGAGGCCTGGGAGTGCCTGG + Intergenic
1132827761 16:1913616-1913638 GAGTCAGGGCTGGGCGTGACTGG - Intronic
1132842606 16:1985512-1985534 GAGTGTGGCCTGGGTGGGGCTGG - Intronic
1132879000 16:2153018-2153040 GAGGGAGGACGGGGAGAAGCTGG + Exonic
1132904283 16:2274170-2274192 GCGTGGGGACCGGGAGGGGCAGG - Intergenic
1133598943 16:7320311-7320333 GAGTGAGAACATGGAGTGTCTGG + Intronic
1133775235 16:8890227-8890249 GAGTGAGGCCTGGGAGCTGGAGG - Intergenic
1135081016 16:19435660-19435682 GAGTGATGACTAGGAATTGCAGG - Intronic
1136016358 16:27403517-27403539 GAGTGAGGAAGGCGCGTGGCCGG - Intronic
1136070019 16:27782127-27782149 GGCTGAGGAGTGGGAGTGACAGG - Intergenic
1136281028 16:29211459-29211481 GGGTGAGGACTGGGAGAGTGGGG - Intergenic
1136368441 16:29820761-29820783 GAGAGAGGCCTGAGAGTTGCAGG - Intronic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1136552060 16:30987001-30987023 GGGTGAGGACTGGGCTAGGCAGG + Exonic
1136983710 16:35081660-35081682 GGGAGAGGAGTGGGAGTGACTGG + Intergenic
1136999270 16:35215189-35215211 GAGTGTGGCCTGGAAGTGGAAGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138140273 16:54562329-54562351 GAGAGAGGACTGGGTGTACCGGG - Intergenic
1138629277 16:58280578-58280600 GAGTGAGGACAGGGGAGGGCCGG + Exonic
1140054635 16:71515317-71515339 CAGTGAGGAATGGGATGGGCTGG + Intronic
1141433086 16:83980971-83980993 GAGTGCTGAGTGGGAGGGGCAGG + Intronic
1141496052 16:84410500-84410522 GAGGGGGGACAGGGCGTGGCAGG - Intronic
1141993315 16:87622352-87622374 GAGCAAGGACAGAGAGTGGCTGG + Intronic
1142085386 16:88177382-88177404 GGGTGAGGACTGGGAGAGTGGGG - Intergenic
1142159799 16:88551261-88551283 GGGTAAGGACTGGGGGTGTCTGG - Intergenic
1142618464 17:1150598-1150620 GATCTAGGACTGGGAGTGGACGG - Intronic
1142687001 17:1583177-1583199 GTGTGGGGAGTGGGAGGGGCAGG - Intronic
1142982157 17:3678584-3678606 GAGTGAGGAGAGAGAGAGGCAGG - Intronic
1142985067 17:3690556-3690578 GAAGGAGGACTCGGAGTGGGAGG - Intronic
1143496796 17:7317184-7317206 CAGTGAGTACTGGGAGGGGTGGG - Exonic
1144447827 17:15347422-15347444 GAGTGAGGAGTGGAAGGGGAGGG + Intergenic
1144447850 17:15347507-15347529 GAGTGAGGAGTGGAAGGGGAGGG + Intergenic
1144447862 17:15347550-15347572 GAGTGAGGAGTGGAAGGGGAGGG + Intergenic
1144713407 17:17418022-17418044 TGGTGAGGACTGACAGTGGCAGG - Intergenic
1144775856 17:17784223-17784245 GAACGGGGACTGGGAGGGGCTGG + Intronic
1144944781 17:18964319-18964341 GAGTGAGGACAGAGACTGGGTGG - Intronic
1145124011 17:20285751-20285773 GAGGGAGGACAGGGAGGGGGAGG - Intronic
1146551321 17:33782720-33782742 GGGGGAGTAGTGGGAGTGGCAGG - Intronic
1146648702 17:34592707-34592729 GAGTGAGCACTGACAGTGTCAGG - Intronic
1147377448 17:40031291-40031313 TGGTGAGGGGTGGGAGTGGCAGG + Intronic
1147446765 17:40479497-40479519 GAGTGAGGCCTGGAGGAGGCAGG + Intronic
1147935133 17:44006746-44006768 GAGTGAGTACTGGCCGGGGCTGG + Intronic
1148756567 17:49976162-49976184 TGGTGAGGAATGGGAGTGCCAGG + Intergenic
1149250327 17:54760839-54760861 GAGTGGGGACTGGGAGAAGTGGG - Intergenic
1150098438 17:62399764-62399786 AAGTGGGGACAGGGAGTGGTAGG - Intronic
1151416426 17:73968951-73968973 GAGTGATGGCTGGGAGAGGAAGG - Intergenic
1151823328 17:76509090-76509112 GAGGGAGGATTGGGAGAGGGAGG + Intergenic
1152739268 17:82011924-82011946 GTGGGTGGACAGGGAGTGGCTGG + Intronic
1153033023 18:732701-732723 GAGTGGGGAGAGGGAGAGGCAGG + Intronic
1153985648 18:10348632-10348654 GAGTGAGGAGTGGGAAGGGGAGG + Intergenic
1155507906 18:26549458-26549480 CAGAGAAGACTGGGAGGGGCCGG + Intronic
1156492068 18:37502205-37502227 GAGGGAGGAATTGGACTGGCAGG - Intronic
1157053576 18:44198482-44198504 GAGTGAGCCCTGGAAGAGGCCGG - Intergenic
1157289088 18:46397241-46397263 GAGTGAGGACTGGGGGTGGGAGG + Intronic
1157595166 18:48859814-48859836 GAGTGAGGAAGGGGAGGGCCAGG - Exonic
1157606642 18:48930101-48930123 GAATGAGGGCTGGGAGTGCACGG - Intronic
1158190974 18:54828471-54828493 CCGTCAGGACTGCGAGTGGCAGG - Exonic
1158404795 18:57151537-57151559 GAGAGAGGGTTGGGAATGGCAGG + Intergenic
1160019280 18:75167819-75167841 AGGTGAGGACTGGGAGGGGCAGG - Intergenic
1160916133 19:1497542-1497564 GAGGGCTGACTGGGAGGGGCTGG - Exonic
1161078895 19:2300698-2300720 GACGGAGGCCTGGCAGTGGCGGG - Intronic
1161196855 19:2991654-2991676 GGCTGAGGGCTGGGAGGGGCCGG + Intronic
1161244444 19:3241562-3241584 GTGTGTGGGGTGGGAGTGGCTGG + Intronic
1161470909 19:4456412-4456434 GAGTGGGGGCTGGGAGAGGCAGG - Intronic
1161594923 19:5146260-5146282 GAGTGGTGACTGGGCGGGGCCGG - Intronic
1161649882 19:5477947-5477969 GAGTGAGGAGGGGGAGAGGAGGG - Intergenic
1161836606 19:6651796-6651818 GAGAGACAACTGGGAGTGGTGGG + Intergenic
1162029829 19:7912547-7912569 GACTGAGGACAGAGAGTGGGGGG + Exonic
1162413020 19:10517690-10517712 GTGGGAGGACTCGGAGAGGCGGG + Intronic
1162541544 19:11299416-11299438 TTGTGAGGACTTGGAGAGGCAGG - Intronic
1162735987 19:12747361-12747383 GAGAGAGGACAGTGAGGGGCGGG - Intronic
1162965696 19:14155046-14155068 GAGTCAGGCCTGGGAGAGGGAGG - Intronic
1163432496 19:17276627-17276649 GGGTGAGGCCTGGGAGAGGGAGG + Intronic
1163473739 19:17512714-17512736 GAGGGAAGAGTGGGAGGGGCGGG + Intronic
1163582128 19:18145232-18145254 GAGTGCCGAGTGGGAATGGCAGG + Intronic
1163762893 19:19146717-19146739 GAGTGAGGGGAGGGTGTGGCAGG - Intronic
1164671784 19:30076555-30076577 CAGTGAGGGGTGGGAGAGGCAGG - Intergenic
1165915249 19:39254618-39254640 GGGTGTGGTCTGGGCGTGGCTGG - Intergenic
1165993599 19:39829859-39829881 AGGTGAGGCCTGGGACTGGCAGG - Exonic
1166705198 19:44904492-44904514 CAGTGAGAACTGGGAGAGACTGG - Intergenic
1167148344 19:47695351-47695373 GAGGGAGGCCTGGGGGTGGGTGG - Exonic
1167466524 19:49653335-49653357 GAGTGAGGGCAGGGGGTGGTGGG - Exonic
1167493106 19:49803004-49803026 AAGTGAGTCCTGGGAGTGGTGGG + Exonic
1167615438 19:50530345-50530367 GAGTGAGGGCTGCGAGTGAGGGG - Intronic
1167637384 19:50662655-50662677 GAGTGAGGACTGGGAGTCGTCGG + Exonic
1168133861 19:54337711-54337733 GAGTTGGGACTCGGAGCGGCTGG + Intronic
1168517267 19:57018193-57018215 GAGTCAGGACTGGGAAGGGGAGG - Intergenic
1168686681 19:58353259-58353281 GGGTGAGGTCTGGGAATGGTGGG - Intronic
925020637 2:564972-564994 GTGTGAGGATAGGGGGTGGCCGG + Intergenic
925122433 2:1429766-1429788 GAGTGATGACTTGGAGTATCTGG + Intronic
925281974 2:2691086-2691108 GAGTGAGGAGAGGGAGTGAGAGG - Intergenic
925353751 2:3222694-3222716 GAGGGAGGCCTGGGCGTGGAGGG + Intronic
926422096 2:12709934-12709956 GGGAGAGAACAGGGAGTGGCAGG + Intergenic
926803509 2:16683461-16683483 GAGACAGGATTGGGAGTGGAAGG + Intergenic
927156744 2:20225161-20225183 GGGTGTGGACTGGGGCTGGCCGG - Intronic
927227286 2:20780911-20780933 TTGCCAGGACTGGGAGTGGCAGG - Intronic
928309792 2:30200045-30200067 GAGTGAAGAATGGGAGAGGGTGG - Intergenic
928324833 2:30311168-30311190 GAGGGAGGAGGGGGCGTGGCAGG + Intronic
929379468 2:41333433-41333455 GAGTGAGGCTTGGGAGTTGATGG - Intergenic
929888835 2:45902878-45902900 GAGTGAGCACTGGGAGTTTCTGG + Intronic
930752212 2:54945092-54945114 GAGGGAGGAGTGGGAGAGGAGGG - Intronic
931195274 2:60047037-60047059 AAGTGAGGACTGTGAGTGGTCGG + Intergenic
932304623 2:70693240-70693262 GAGAGCGTACTGGGAGGGGCTGG - Intronic
932320912 2:70821408-70821430 GAGTAGGGAATGGGAGTGGGTGG - Intergenic
932440435 2:71731343-71731365 GAGTGGGGACTGGAAGAGTCTGG - Intergenic
934555023 2:95282516-95282538 GACTGAGGACAGGCATTGGCTGG + Intronic
934843498 2:97646359-97646381 GAGTGAGTTCGGGGAGCGGCAGG - Intronic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935130613 2:100258380-100258402 GAGCCAGGAGTGGGAGGGGCAGG - Intergenic
936271603 2:111053557-111053579 GAGTGGGGACAGGGAGGGTCTGG - Intronic
936519401 2:113202166-113202188 GAGTGAGGGCTGGGCGGGGTGGG + Exonic
936918846 2:117667397-117667419 GAGGGAGGATTGGGACTGGGAGG + Intergenic
937441366 2:121918717-121918739 GGGTGACAACTGGGAGAGGCTGG + Intergenic
937937826 2:127260172-127260194 GAGTCATGACGTGGAGTGGCTGG - Intronic
938120198 2:128627636-128627658 GAGTGTGGACTGCGAGAGGATGG - Intergenic
938746863 2:134287514-134287536 GAGTGAGGGCTGGCAGCTGCTGG + Intronic
938901569 2:135802720-135802742 GAGGGAGGACAGGGAGAGGTTGG + Intronic
939630580 2:144523075-144523097 GAGAGAGGACTGGGGGCTGCTGG + Intronic
940683641 2:156818812-156818834 CATTTAGCACTGGGAGTGGCAGG - Intergenic
941983630 2:171487936-171487958 GAGATAAGACTGGGAGAGGCTGG - Intergenic
943867426 2:192944343-192944365 AAGTGAGGACTGGGAGTGAGAGG + Intergenic
944155558 2:196603859-196603881 GAGAGAAAACTGAGAGTGGCCGG + Intergenic
944331342 2:198469811-198469833 GAGGGTGGACTGGCATTGGCTGG - Intronic
944832813 2:203549734-203549756 GGATGTGTACTGGGAGTGGCTGG - Intergenic
945525592 2:210884585-210884607 GAGTGAAGACTGGGAATTGTGGG + Intergenic
945694575 2:213086775-213086797 TAGTGTGGAATGGGAGTGGAGGG + Intronic
945779282 2:214148194-214148216 GAGTGAAGACTATGAGTTGCTGG + Intronic
948070125 2:235114165-235114187 CAGAGAGCACTGGGAGTGCCGGG - Intergenic
948495179 2:238344184-238344206 GAGTGGAGACTGGCAGTGTCAGG + Intronic
948571566 2:238920931-238920953 GGGTGAGGACTGGAAGTGGCTGG + Intergenic
948661229 2:239507879-239507901 GAGTGAGGAATCGGAGAGGCTGG + Intergenic
948725497 2:239931312-239931334 GTGTGAGGACGGGCAGGGGCTGG - Intronic
948861624 2:240755330-240755352 GAGCGAGGGCTGAGTGTGGCGGG + Intronic
1168891815 20:1299888-1299910 GGGTGAGGAGTGAGAGTGCCAGG + Intronic
1168892590 20:1304695-1304717 TAGTGGGGAGTGAGAGTGGCTGG - Intronic
1168956162 20:1835936-1835958 GAATGAGAAGTGGGTGTGGCTGG - Intergenic
1168968260 20:1913272-1913294 GAGTCAAGACTGGGTGAGGCTGG + Intronic
1169245102 20:4018852-4018874 CAGTGGGGGCTGGGAGTGGTGGG - Intergenic
1169636633 20:7699519-7699541 TAGTGATGACTGGCAGTGGAGGG - Intergenic
1170579041 20:17684192-17684214 CAATGAGGACTGGGAGTGGCTGG - Intergenic
1170594784 20:17796961-17796983 GATTTAGGAAAGGGAGTGGCTGG + Intergenic
1172083123 20:32358305-32358327 GAGTGAGGAGGGGGAGTGTGGGG - Intergenic
1172312823 20:33931546-33931568 CAGAGAGGAGTGGGAGTGGTTGG + Intergenic
1173283735 20:41652072-41652094 GAGTGAGTTCTGGGATTAGCAGG + Intergenic
1173615734 20:44401735-44401757 CAGTGAGGACTGGAAGGGCCTGG - Intronic
1173629885 20:44504853-44504875 GAGGGAGGACTGCAAGAGGCCGG + Exonic
1173666422 20:44766456-44766478 GGATGGGGACTGGGAGAGGCTGG + Intronic
1173987287 20:47271528-47271550 GAGTGAGGTTGGGGAGTGGTAGG - Intronic
1174181949 20:48680539-48680561 GAGTGAGGAGGGGGCGTGGTAGG - Intronic
1175114744 20:56674087-56674109 CAGTGAGGAGTGGAAGGGGCCGG + Intergenic
1175189604 20:57202443-57202465 GCATTAGGACTGGCAGTGGCCGG + Intronic
1175445266 20:59015554-59015576 GTGTGAGGACTGGGCCTGCCAGG - Intergenic
1175563722 20:59955241-59955263 CAGTGAGAACTGGAGGTGGCTGG + Intergenic
1175838905 20:62014426-62014448 GAGTGAGGACTGGGAAGTGTGGG - Intronic
1176032044 20:63017379-63017401 GAGAGAGGACGGGGAGGGACTGG + Intergenic
1176128157 20:63485181-63485203 GGGTGGGGACCGGCAGTGGCTGG - Intergenic
1176389777 21:6157487-6157509 GAGTGAGTCCTGGGAGGGCCGGG + Intergenic
1178910589 21:36670132-36670154 GTGGGAGGGCTGGGAGTAGCTGG + Intergenic
1179176341 21:39010759-39010781 GAGGGAGGCCTGGGGGTGGCAGG - Intergenic
1179502571 21:41819486-41819508 GAGCGAGAACTGGGAGTGTGGGG - Intronic
1179733690 21:43380751-43380773 GAGTGAGTCCTGGGAGGGCCGGG - Intergenic
1180252385 21:46597886-46597908 GAGAGGGGCCTGGGAGAGGCCGG - Intergenic
1181042974 22:20201588-20201610 GGCTGAGGACTGGGGGTGGATGG + Intergenic
1181271938 22:21664195-21664217 GAGTGGGGACTGGGAGAAGAGGG + Intronic
1181487610 22:23241460-23241482 GAGTGAGGTCTGAAAGTGACTGG - Intronic
1181694908 22:24588180-24588202 CAGTGAGGAGGGGCAGTGGCTGG + Intronic
1181695877 22:24592634-24592656 GAGTGAGGGCTGGGTGAGGTCGG - Intronic
1182475872 22:30575942-30575964 GAGTGAGCACTGGGAGACCCAGG + Intergenic
1182567646 22:31212182-31212204 GAGCGAGGCCTGAGAGCGGCGGG + Intergenic
1183006891 22:34911033-34911055 GAGTGGGGACTAGGATAGGCGGG - Intergenic
1183030810 22:35103067-35103089 GAGTGAGGACTGTGAGGGGTGGG - Intergenic
1183066551 22:35367561-35367583 GCGAGAGGACTGGGCGTGCCAGG - Intergenic
1183107047 22:35622342-35622364 GGCTGAGGCCTGGGAGTTGCAGG + Intronic
1183119301 22:35717779-35717801 AGGTGAGGACTGGGAGAGACAGG + Intergenic
1183357329 22:37366750-37366772 GAAGGAGGCCTGGGACTGGCAGG + Intergenic
1183583167 22:38737619-38737641 GAGTGAGGAATTGGGTTGGCGGG - Intronic
1184333075 22:43838176-43838198 GAGTAAGGACTGGGAGCGAGTGG + Intronic
1184353953 22:43965619-43965641 GAGAGCAGACTGGGATTGGCCGG - Intronic
1184751057 22:46487021-46487043 GAGTGAGGGCAGGAAGTGGAGGG - Intronic
1185177999 22:49341254-49341276 GAGAGAGGTGTGGGAATGGCTGG - Intergenic
1185291880 22:50031369-50031391 CAGTCAGGACTGGGTGAGGCTGG + Intronic
949468628 3:4370100-4370122 GAAAGAGGACTGAGAGTGACTGG + Intronic
949534799 3:4987224-4987246 GAGGGAGGACTGGGTGGGGTAGG + Intergenic
950077266 3:10195954-10195976 AGATGAGGACTGGGAGTGGCGGG + Intronic
950471889 3:13191447-13191469 GTGTGGGGACTGGGAGCTGCAGG - Intergenic
950531332 3:13553847-13553869 GTGTGAGACCTGGGACTGGCAGG - Intronic
952345297 3:32478262-32478284 GAGTGGGGACTGGGAGAGGTTGG + Intronic
952844412 3:37674984-37675006 GAGTGAGGCCTGTCACTGGCAGG - Intronic
952888858 3:38028256-38028278 GAGGGAGCACTGGAAGGGGCAGG + Intronic
953030336 3:39175802-39175824 GAGTGAGAAGAGGGAGTTGCTGG - Intergenic
953060670 3:39426476-39426498 GACACAGGACTGGGACTGGCAGG + Intergenic
953608471 3:44427890-44427912 GAGTGAGTGCTGTGATTGGCTGG + Intergenic
953816578 3:46163165-46163187 GAGTGACCACTAGGAGGGGCAGG - Intergenic
954622311 3:52003213-52003235 GAGTGAGGACTGGGAGACTTGGG - Intergenic
955238075 3:57157317-57157339 GAGAGAGGACGGGGAGTGCTCGG + Intronic
955322064 3:57981650-57981672 GAGCGAGGACTGGGAAGCGCTGG + Intergenic
956081404 3:65560608-65560630 GGGAGAGGAGTGGGAGTAGCAGG - Intronic
956084685 3:65597262-65597284 GAATGGGGACTGGGGGTGGGAGG - Intronic
956488130 3:69742625-69742647 GAGTGAGCACTGGGTCTGTCTGG - Intronic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
956675829 3:71731052-71731074 GAGTGAGGACTGGGAGTGGCTGG - Intronic
956742684 3:72287396-72287418 CAGTGAGGACTGCGAGCTGCGGG - Intergenic
959579984 3:107973535-107973557 GAGGGAGGAATGGAAGAGGCAGG + Intergenic
960483116 3:118217375-118217397 GAGAGAGGATAGGGAGAGGCTGG + Intergenic
961035485 3:123638743-123638765 GTGTGAGGAGTAGGAGAGGCAGG - Intronic
961684686 3:128621543-128621565 GAGTGAGGAGAGGGAATGCCAGG + Intronic
961798643 3:129427763-129427785 GAGAGGCCACTGGGAGTGGCAGG - Intronic
961954741 3:130789744-130789766 GAGTGGGAACTGGAAGTGGTAGG + Intergenic
962768810 3:138593732-138593754 GAGTGAGGACTCGGAGCAGAAGG - Intronic
964607130 3:158571635-158571657 GAGTTAAGGCTGGGAGTGGGGGG + Intronic
964636865 3:158867388-158867410 GAGTGAGGGATGGGATTGGAAGG + Intergenic
964987182 3:162758150-162758172 GAGTGATGACCGGGCGTGGTTGG + Intergenic
965226658 3:165999980-166000002 GGGTGATGTCAGGGAGTGGCTGG + Intergenic
965427121 3:168540842-168540864 GAGAGAGGAATGGGAGTGGTGGG - Intergenic
965811139 3:172592650-172592672 CAGTGAGGACTGGGACTTGTGGG + Intergenic
966827305 3:183975843-183975865 TAGTGAGGACTTGGATTAGCAGG - Intronic
967123381 3:186403698-186403720 GAATGAGGACTAGGGGTGGGAGG - Intergenic
967965037 3:194954277-194954299 GAAAAAGGCCTGGGAGTGGCTGG - Intergenic
968085509 3:195872255-195872277 GAGTGAGTACTGGGCGGGGATGG - Exonic
968315193 3:197718108-197718130 GAGGGAGCACTGGCAGTTGCTGG - Exonic
968772432 4:2516238-2516260 GAGTCAGCACTGGGAGTGCATGG + Intronic
968784018 4:2605279-2605301 GAGTGAGGACTAGGAGCAGCCGG - Intronic
969212821 4:5700770-5700792 GAGGGATGACAGGGAGGGGCAGG - Intronic
969298569 4:6283777-6283799 CCATGAGGACTGAGAGTGGCGGG + Intronic
969396127 4:6922759-6922781 GCGTGAGGACTGGGCTTGGGGGG - Intronic
972747541 4:41952631-41952653 GAGCGAGGGCAGGGAGTGGCAGG + Intronic
973196022 4:47443007-47443029 GAGTCAGGAGTGGGGGTGGGTGG - Intergenic
973686634 4:53377293-53377315 CAGTGAGGAAAGGGAGTGACAGG + Intergenic
973879096 4:55250723-55250745 GAGTGAGGTCTGGAAGTGTCTGG - Intergenic
974018837 4:56675251-56675273 GAATGAGGACTGGGGCTGACTGG + Intronic
974021827 4:56698400-56698422 GAGTGAGGAGGGGGAGGGGCAGG - Intergenic
974409242 4:61517536-61517558 GAGAGAGGGCTGGGGGTGGCTGG + Intronic
976821713 4:89214269-89214291 GACTGGGTACTGGGAGTGGGTGG + Intergenic
976895895 4:90110738-90110760 GAGAGAGAAATGGGAGTGGGAGG + Intergenic
977724846 4:100284206-100284228 CATTGAGGAGTGGGACTGGCAGG + Intergenic
978862888 4:113471728-113471750 CAGTGAGGAGTGAGAGAGGCCGG - Intronic
981198083 4:141943571-141943593 GAGTGAGGACTATGATGGGCAGG - Intergenic
982093073 4:151897090-151897112 GACTGAGGTCTGGGAATGCCCGG - Intergenic
985543903 5:499825-499847 GACCCTGGACTGGGAGTGGCTGG - Intronic
985670751 5:1205431-1205453 CAGAGAGGACTGGGGGTGGGGGG - Intronic
985765466 5:1777193-1777215 GAGAGGGGACAGGGAGTGACAGG - Intergenic
986436999 5:7744129-7744151 GAGTGAGGACAGGCAGTGTTTGG - Intronic
986722089 5:10566553-10566575 GAGTGGGGACTGGGCGAGCCAGG - Intronic
986817375 5:11427735-11427757 GAATGAAGTCTGGGAGAGGCAGG - Intronic
989201498 5:38769025-38769047 GAGTGAGTACAGGGGGTAGCCGG - Intergenic
990621762 5:57567637-57567659 GAGTGGGGAATTGGTGTGGCAGG + Intergenic
992116425 5:73542626-73542648 GAGTGAGGTCTTGCAGTTGCTGG + Intergenic
992925421 5:81580114-81580136 CTGTGAGGAATGGGAGTGGTTGG + Intronic
994353727 5:98773431-98773453 GAGAGAGGACTTGGAGTCGATGG + Intronic
995226308 5:109705143-109705165 GAGTTAGGAATGGGAGGGGCAGG - Intronic
996437099 5:123446529-123446551 GAGTGAGGACAGGGAGTATATGG + Intergenic
996995113 5:129686502-129686524 GAGAGGGGTCTGGTAGTGGCAGG + Intronic
997592928 5:135086657-135086679 GAGTGAGAGCTGGGTGGGGCAGG + Intronic
997719353 5:136065556-136065578 AAGTCAGGGCAGGGAGTGGCAGG - Intergenic
998275976 5:140753690-140753712 GAGTGAGGGGAGGGAGTGGGTGG + Intergenic
999424678 5:151476880-151476902 CAGTGAGGGCTGGCAGTGGCAGG - Intronic
1000370950 5:160536147-160536169 GAGTGAGAATTGGGAGTGTACGG + Intergenic
1001384555 5:171328095-171328117 GGCTGAGGACTGGGGGTGGGGGG + Intergenic
1001420018 5:171579141-171579163 TAGTGAGGTGTGGGAGTGGGTGG + Intergenic
1001593247 5:172880840-172880862 GAGTGGGGACTGGGGCTAGCTGG - Intronic
1001977114 5:176009214-176009236 CAGTTAGGAATGGGAGAGGCAGG - Intronic
1002100829 5:176856769-176856791 GCGTGAGGAGTGGGAGGGGAGGG - Intronic
1002240313 5:177834566-177834588 CAGTTAGGAATGGGAGAGGCAGG + Intergenic
1002532783 5:179858667-179858689 GACAGCGGACGGGGAGTGGCGGG - Intronic
1002539838 5:179899156-179899178 GGGTGAGAACAGAGAGTGGCGGG + Intronic
1002778695 6:349918-349940 AAGTGAGGACAGCGAGAGGCTGG - Exonic
1003292828 6:4794486-4794508 GAAAGAGAACTGGGAGTGCCGGG + Intronic
1003670519 6:8153717-8153739 GAATGAGGACTGGAAGGAGCTGG + Intergenic
1004447542 6:15714086-15714108 GAGTGATGAGAGGGAGTGACTGG + Intergenic
1006089490 6:31620228-31620250 GAGAGAGGACGGGGGCTGGCGGG - Intergenic
1006309683 6:33249039-33249061 GAGTGACACCTGGGAGTGGGTGG + Intergenic
1006310131 6:33251491-33251513 GAGTGGGGCCTGGGACTTGCAGG + Intronic
1006618224 6:35343850-35343872 GAGTGAGGGCAGAGAGAGGCTGG - Intronic
1007078620 6:39083496-39083518 GAGTGGGGACAGGGAGGGGGAGG + Intronic
1007115633 6:39341205-39341227 GCCAGGGGACTGGGAGTGGCTGG - Intronic
1007234231 6:40378868-40378890 GAGTCAGGCCTGGGAGGGGCCGG - Intergenic
1007265175 6:40590396-40590418 GAGTCCTGATTGGGAGTGGCAGG - Intergenic
1008506481 6:52235949-52235971 GGGTGTGGAATGGGAGTGGTTGG - Intergenic
1009614876 6:65991147-65991169 GAGTAAGGAGTGTGATTGGCAGG + Intergenic
1010126909 6:72443027-72443049 AAGTGTGGTCTGGGAGTGGAAGG + Intergenic
1011464281 6:87639565-87639587 GGGTCAGGCCTGGGAGGGGCTGG - Intronic
1012231185 6:96762636-96762658 GAGGGAGGACTGAGGGTAGCTGG - Intergenic
1013754214 6:113441820-113441842 GAGGGAGGACTGGGGGAGGGAGG + Intergenic
1015583053 6:134747263-134747285 GAGTGAGAACTTGGAGTGTTTGG + Intergenic
1017879459 6:158549766-158549788 GAGGTTGGACTGGCAGTGGCTGG + Intronic
1018307292 6:162471045-162471067 GAGTGTGGGCTGGGCGTGGTGGG - Intronic
1018533592 6:164794804-164794826 GAGTGATGCCTGTGATTGGCTGG - Intergenic
1019404727 7:877416-877438 GAGTGAGGGCAGGGGGAGGCCGG - Intronic
1019453448 7:1111848-1111870 GAGTGAGGACTCGCTGTGGATGG + Intronic
1019496874 7:1344878-1344900 GAGACAGGACGGGGAGGGGCTGG + Intergenic
1019723237 7:2586396-2586418 GAGGGAGGCCAGGGAATGGCAGG + Intronic
1020208586 7:6139929-6139951 CAGGGAGGTCTGGGAGTGGCGGG - Intronic
1021272513 7:18608279-18608301 GAGAGAGGAGTGGGAGGGGAGGG + Intronic
1021970640 7:25962515-25962537 GATGGAGGACTGGGACTGGGAGG - Intergenic
1022112071 7:27238051-27238073 GGGTGAGGGATGGGGGTGGCAGG + Intergenic
1022948321 7:35310480-35310502 GAGTGAGGTCTGGGTGTGGGAGG - Intergenic
1023091315 7:36619963-36619985 ATGTGAGTACTGGGAGTGACTGG + Intronic
1023997716 7:45172115-45172137 AAGTGGGGACTGGGCGGGGCAGG + Intronic
1024159891 7:46663427-46663449 GAGTGGGGAAGGGGAGTGGAAGG - Intergenic
1024243163 7:47450799-47450821 CAGTGAGGACAAGGAGAGGCAGG - Intronic
1024350762 7:48360271-48360293 GAGTGAGGACATGGAGTGTTTGG + Intronic
1026828345 7:73597229-73597251 GTGGGGGGACTGGCAGTGGCAGG + Exonic
1027233482 7:76284845-76284867 GAGTGAGGAGTGGGGCCGGCGGG + Intronic
1027338750 7:77182888-77182910 GTGGGAGGCCTGGGAGTGGTGGG - Intronic
1027591822 7:80127885-80127907 GATAGAGGACTGGGAGTAGGAGG - Intergenic
1028035618 7:85978105-85978127 GAGTGGGTGTTGGGAGTGGCAGG + Intergenic
1029419693 7:100466324-100466346 AAGTGAGGATTGGGGGTGGGGGG - Intronic
1029642272 7:101828799-101828821 AAGTGAGGGCTGGGAGAGGAGGG + Intronic
1030115354 7:106058686-106058708 GAGGGAGGACAGGGCGGGGCAGG - Intergenic
1031026575 7:116686068-116686090 GAGAGAAGACTGCTAGTGGCTGG - Intronic
1031975526 7:128091186-128091208 GAGTCAGGAATGGGAGGGGAAGG + Intronic
1032549167 7:132768376-132768398 GAGGGAGGCCTGGGAGTGAACGG - Intergenic
1034217303 7:149418164-149418186 GACTGAGTCCTGGGAGTGGCTGG - Intergenic
1034360071 7:150487730-150487752 GTGTGAGGATAGGGAGTGCCTGG - Intergenic
1034426649 7:151017556-151017578 GGGTGAGGAATGGGCTTGGCCGG - Intronic
1034639447 7:152590999-152591021 GAGTGAGGAGCGGGAGCGGGTGG + Intergenic
1035252622 7:157607139-157607161 GAGTGAAAATTGGCAGTGGCAGG + Intronic
1035363936 7:158333525-158333547 GAGTGACGTCTGCGAGTGTCAGG - Intronic
1035364617 7:158340166-158340188 GAGTGACGTCTGCGAGTGTCAGG - Intronic
1035574950 8:698317-698339 GACTGAGGAATGAGAGTCGCTGG - Intronic
1036170184 8:6475946-6475968 CATTGAGGACTGGGGGTGGCAGG + Intronic
1037653883 8:20866488-20866510 GAGTGAGGGCTGTGGGTGGTGGG + Intergenic
1037952549 8:23028444-23028466 GAGAGAGAACAGGGAGAGGCAGG + Exonic
1038420431 8:27430822-27430844 GAGTGAGACCTGGGAGGAGCAGG + Intronic
1038570806 8:28660716-28660738 GAGAGTGGAGTGGGAGTTGCCGG - Intronic
1038577965 8:28721646-28721668 GAGGGAGGACTGGGTCTGGCAGG + Intronic
1039072474 8:33659400-33659422 GAGAGGGGACTGGAAGTGGGTGG - Intergenic
1039971074 8:42322180-42322202 GAGGAAGGACTGGGAGATGCAGG + Intronic
1041715041 8:60924706-60924728 GGGATAGGACTGGGAGGGGCTGG - Intergenic
1043388607 8:79770032-79770054 GACTGAAGACTGGGAGGGCCAGG - Intergenic
1045496997 8:102717398-102717420 GCTGGAGGACTGGGAGTGGCTGG + Intergenic
1048973976 8:139661101-139661123 GACTTTGGCCTGGGAGTGGCTGG - Intronic
1049047213 8:140162247-140162269 GTGTGAGTTCAGGGAGTGGCAGG - Intronic
1049248757 8:141577104-141577126 GAGTGGGGGCTGGGGGTGCCAGG - Intergenic
1049271283 8:141697566-141697588 GAGTGAGTGCTGGGTGTGGTAGG + Intergenic
1049473652 8:142787218-142787240 GAGTGAGGACTGTGAGGACCCGG + Intergenic
1049694616 8:143977218-143977240 GGGCGAGGTCTGGGAGCGGCGGG + Exonic
1049728610 8:144163855-144163877 GCATGGGGATTGGGAGTGGCCGG + Intronic
1049795347 8:144494798-144494820 GGGTGTGGGCTGTGAGTGGCTGG + Intronic
1050096483 9:2072816-2072838 TAGTGAGGACAGGCTGTGGCTGG + Intronic
1052976048 9:34411040-34411062 CAGTGTGCCCTGGGAGTGGCTGG + Intronic
1053420719 9:37975833-37975855 GTGTAGGGCCTGGGAGTGGCAGG + Intronic
1054454199 9:65421086-65421108 GAGTGAGAGAGGGGAGTGGCAGG + Intergenic
1055560225 9:77515011-77515033 CAGTGAGGCCTGGGAGAAGCAGG + Intronic
1056486614 9:87064559-87064581 GAAAGAGGACAGGGAGTGCCTGG - Intergenic
1056817090 9:89809884-89809906 GAATTGGGACAGGGAGTGGCAGG - Intergenic
1057279989 9:93702178-93702200 CAGTCAGGACTGGGAGGGGGTGG + Intergenic
1057802787 9:98200213-98200235 GTGTGAGTGGTGGGAGTGGCAGG + Intronic
1058753668 9:108064246-108064268 AAGTGGGGAGTGGGAGGGGCTGG - Intergenic
1059259772 9:112964313-112964335 GAGTTAGGAGTGGCAGTGGGAGG - Intergenic
1059630387 9:116115827-116115849 GATTGACGACTGGAAGTTGCAGG - Intergenic
1060051897 9:120383839-120383861 GAGTGTGGAGTGGGTGTGGGAGG - Intergenic
1060354435 9:122891658-122891680 GAGCGTGGACTGAGAGTGTCAGG - Intronic
1060801978 9:126550737-126550759 GAGTGATGACTGCTAGTGGTGGG - Intergenic
1060893219 9:127201711-127201733 GGGTGAGAGCTGGGAGTGGAGGG - Intronic
1061264001 9:129495321-129495343 GGGTGAGGGCAGGGAGGGGCTGG - Intergenic
1061995597 9:134181245-134181267 GCGTGGGGACTGGGATTGGGAGG + Intergenic
1062283901 9:135764657-135764679 CAGTGAGGCCTGCGAGTGCCTGG + Intronic
1062530029 9:136995733-136995755 GAGTGAGGACGGGGAGAGCGTGG - Exonic
1062681602 9:137784982-137785004 GGGTGAGGTCAGGGAGTGGGGGG + Intronic
1203489268 Un_GL000224v1:87808-87830 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1203501889 Un_KI270741v1:29703-29725 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1186661651 X:11673952-11673974 TAGACAGGACTGGGAGTGTCGGG + Intergenic
1186932938 X:14414516-14414538 GAATGGGGGTTGGGAGTGGCAGG + Intergenic
1187496457 X:19799826-19799848 GAGTGTGTAGTGGGAGGGGCAGG - Intronic
1188214145 X:27457846-27457868 GAGTGAGGAGAGGGAGAGGGAGG - Intergenic
1188807397 X:34608431-34608453 AAGTTAGGATTGGGAGGGGCTGG + Intergenic
1188841148 X:35019306-35019328 GAGTGTGGAGTGGCAGTAGCAGG - Intergenic
1189638051 X:43033783-43033805 GAGTGAGGATTGGGAGGTACAGG - Intergenic
1189958038 X:46296271-46296293 GAGAGGTGAATGGGAGTGGCAGG + Intergenic
1190330459 X:49232038-49232060 TAGGGAGAACTGGGAGTAGCTGG + Intronic
1190688446 X:52894417-52894439 GAGAGAGGCCTGGTAGTAGCTGG + Intronic
1190697537 X:52961375-52961397 GAGAGAGGCCTGGTAGTAGCTGG - Intronic
1192577666 X:72255755-72255777 GAGAGAGGACTCTGAGAGGCAGG + Intronic
1192756234 X:74049423-74049445 CAGTGAGGAATGGCAGGGGCAGG - Intergenic
1194386005 X:93255998-93256020 GAGTGAGCACTGAGAGTCGATGG - Intergenic
1195032037 X:100935736-100935758 GCGTGAGAACTGGAAGAGGCTGG - Intergenic
1195910837 X:109887132-109887154 GATTGAAGACTGTGAGTTGCTGG + Intergenic
1199451359 X:147981782-147981804 GAGAGAGGACAGGAAGGGGCAGG - Intronic
1199987728 X:152964478-152964500 GAGTGAGGAAGGGGAGGGCCCGG + Intronic
1200085110 X:153600207-153600229 GAGAGAGGACTTGGGGAGGCTGG - Intergenic
1200213688 X:154358129-154358151 GAGTGTGGGCTGCGGGTGGCTGG - Intronic
1202164357 Y:21970457-21970479 AAGTGAGGATGAGGAGTGGCAGG + Intergenic
1202226999 Y:22615915-22615937 AAGTGAGGATGAGGAGTGGCAGG - Intergenic
1202316123 Y:23579739-23579761 AAGTGAGGATGAGGAGTGGCAGG + Intergenic
1202554641 Y:26090327-26090349 AAGTGAGGATGAGGAGTGGCAGG - Intergenic