ID: 956678109

View in Genome Browser
Species Human (GRCh38)
Location 3:71753956-71753978
Sequence CCCGAGCTCCGCCGCTCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956678109_956678116 -2 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678116 3:71753977-71753999 GGCCGGGCGGCCTGCGGGAGCGG 0: 1
1: 0
2: 4
3: 56
4: 439
956678109_956678121 8 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678121 3:71753987-71754009 CCTGCGGGAGCGGCGAGGCAGGG 0: 1
1: 0
2: 0
3: 22
4: 202
956678109_956678125 20 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678125 3:71753999-71754021 GCGAGGCAGGGGACGGCCCCGGG 0: 1
1: 0
2: 0
3: 29
4: 323
956678109_956678126 21 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678126 3:71754000-71754022 CGAGGCAGGGGACGGCCCCGGGG 0: 1
1: 0
2: 1
3: 22
4: 230
956678109_956678127 24 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678127 3:71754003-71754025 GGCAGGGGACGGCCCCGGGGCGG 0: 1
1: 0
2: 7
3: 67
4: 604
956678109_956678118 3 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678118 3:71753982-71754004 GGCGGCCTGCGGGAGCGGCGAGG 0: 1
1: 1
2: 5
3: 54
4: 383
956678109_956678115 -7 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678115 3:71753972-71753994 GCTCGGGCCGGGCGGCCTGCGGG 0: 1
1: 0
2: 3
3: 86
4: 1147
956678109_956678114 -8 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678114 3:71753971-71753993 AGCTCGGGCCGGGCGGCCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 190
956678109_956678119 7 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678119 3:71753986-71754008 GCCTGCGGGAGCGGCGAGGCAGG 0: 1
1: 0
2: 6
3: 38
4: 327
956678109_956678123 13 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678123 3:71753992-71754014 GGGAGCGGCGAGGCAGGGGACGG 0: 1
1: 0
2: 2
3: 162
4: 2005
956678109_956678122 9 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678122 3:71753988-71754010 CTGCGGGAGCGGCGAGGCAGGGG 0: 1
1: 0
2: 2
3: 32
4: 378
956678109_956678124 19 Left 956678109 3:71753956-71753978 CCGGCGGAGCGGCGGAGCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 956678124 3:71753998-71754020 GGCGAGGCAGGGGACGGCCCCGG 0: 1
1: 0
2: 1
3: 37
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956678109 Original CRISPR CCCGAGCTCCGCCGCTCCGC CGG (reversed) Intronic
900413813 1:2526066-2526088 CCCCGGCTCCGCCGCTTGGCTGG - Intronic
900427266 1:2586454-2586476 CCCTAGCCCCGCCTCTCCGTTGG - Intergenic
901608104 1:10475130-10475152 CCTGAGCCCCGCCCCTCCCCAGG + Intronic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
903263199 1:22142377-22142399 GCCGAGCTGCGCCGCGCTGCGGG - Intronic
903466422 1:23555064-23555086 CCCGGGCGCCGCAGCGCCGCCGG + Intergenic
906640581 1:47438446-47438468 CCCGGGCCCCGCTGCGCCGCGGG - Exonic
911073154 1:93847815-93847837 CCCGAGCCCCTCAGCTCCCCGGG + Intergenic
916666987 1:166975553-166975575 GCCGAGCTCCCCCGCGCGGCGGG - Intergenic
917944491 1:179954971-179954993 CCGGGGATCCGCCGGTCCGCTGG - Exonic
919949439 1:202348954-202348976 CCCGCGCCTCGTCGCTCCGCAGG - Exonic
920253415 1:204637953-204637975 CCCCAGCTCCGCAGCTCCTGGGG - Intronic
922555152 1:226527318-226527340 CCCGTCCTCCACCGCTACGCAGG - Intergenic
1062959463 10:1561819-1561841 CCCCAGCACCGCCGCTCCCTCGG + Intronic
1063418134 10:5889947-5889969 CTCGACCGCCGCTGCTCCGCGGG + Intergenic
1065614361 10:27504699-27504721 TCCGAGGGCCGCCGCTCGGCCGG + Intronic
1065807700 10:29409961-29409983 TCCGAGGGCCGCCGCTCGGCCGG + Intergenic
1069744319 10:70705375-70705397 CCCGAGCTCGGGCTCTCCGTGGG + Intronic
1070152124 10:73811503-73811525 CCCGGGCTCCGCCGCGTCCCGGG + Exonic
1073059329 10:100724058-100724080 TCCGAGCTGCGCGGCTCCCCGGG + Intergenic
1073091093 10:100940587-100940609 CCTGAGCTCAGGCGATCCGCCGG + Intronic
1074156993 10:110807995-110808017 CCCAAGCTCTGCTGCTCCCCTGG + Intronic
1075854058 10:125613143-125613165 TCCCAGCTCTGCCGCTCGGCTGG + Intronic
1076374008 10:129971740-129971762 CCCGAGCGCCGCGCCCCCGCCGG + Intergenic
1076374025 10:129971783-129971805 CCCGGGATCCGCGGCTCCGTCGG - Intergenic
1077060090 11:614140-614162 CCCGCGCTCCCCCCCTCCCCGGG + Intronic
1077459236 11:2700464-2700486 CCCGAGACCAGCCCCTCCGCCGG + Intronic
1078246101 11:9574150-9574172 CCCGAGCGCCGCCGCTCGCCCGG + Exonic
1078345171 11:10541302-10541324 CCCGCGCTCCGCAGCTCCTGAGG + Intergenic
1078823327 11:14905019-14905041 CCCGGGGTCCGCCGGTCCGCGGG - Intronic
1078986660 11:16605062-16605084 CCCGAGCCCGGCCGCTCCCGCGG - Intronic
1080606613 11:33869523-33869545 CGCTTGCTCCGGCGCTCCGCCGG + Exonic
1081793328 11:45804240-45804262 CCGGATCACCGCCTCTCCGCCGG + Intronic
1083618989 11:64039730-64039752 CCAGAGCACTGCCGCTCCCCGGG + Intronic
1083671967 11:64304973-64304995 CCCGAGTTCCGCAGCTCTGTGGG + Intergenic
1084028343 11:66466740-66466762 GCGGAGCTCCGCCCCTTCGCAGG - Intronic
1084769595 11:71334202-71334224 CCTGAGCTCTGCCCCTCCCCTGG - Intergenic
1085266732 11:75241832-75241854 CCTGCGCTGCGCCGCCCCGCGGG + Exonic
1087188671 11:95230657-95230679 CCCGGGCACCGTCCCTCCGCAGG - Intronic
1092373353 12:7935224-7935246 CCCGACCTCAGGCGATCCGCCGG - Intronic
1097071767 12:56360295-56360317 CCGCAACTCCGCCCCTCCGCAGG + Intergenic
1102074406 12:110048405-110048427 CCCGAGCCCCGTGGATCCGCTGG - Intronic
1102933980 12:116881696-116881718 CTCGCGCTCCGCGCCTCCGCGGG - Intergenic
1103775672 12:123364849-123364871 CCCCAGCCCCCCCGCCCCGCCGG + Intergenic
1103800388 12:123533852-123533874 CCCGCGCTCTGCCGCCCCTCAGG - Intergenic
1106308315 13:28532557-28532579 CCTGAGCCCAGCCGCTCGGCCGG + Intergenic
1114516129 14:23301465-23301487 CCGGAGCTCCGCCACTGCCCGGG + Exonic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1118885985 14:69866207-69866229 CCCCAGCTCGGCCACTGCGCAGG + Intronic
1129424485 15:75454198-75454220 CCCGAGCTCCGCCTATCGGGAGG - Intronic
1130010845 15:80152488-80152510 CCCGAGCCCCGCCCCTCCCCTGG - Intronic
1130010870 15:80152555-80152577 CCTGAGCCCCGCCCCTCCCCTGG - Intronic
1130023718 15:80252169-80252191 CCCGGGCTCGCCCGCGCCGCTGG - Intergenic
1131467683 15:92668403-92668425 CCAGAGCTCCTACGCTCTGCTGG + Intronic
1132741498 16:1415400-1415422 CCCGAACTCAGCTGATCCGCCGG - Intergenic
1141957859 16:87384330-87384352 CCCGAGCTGCGGAGCTCTGCAGG + Intronic
1146208023 17:30921828-30921850 CCCGAGCTCCGCCGACGCGCGGG - Exonic
1146842565 17:36166131-36166153 GCCGATCTCACCCGCTCCGCAGG + Exonic
1146854877 17:36254090-36254112 GCCGATCTCACCCGCTCCGCAGG + Exonic
1146865743 17:36334286-36334308 GCCGATCTCACCCGCTCCGCAGG - Exonic
1146870777 17:36377982-36378004 GCCGATCTCACCCGCTCCGCAGG + Exonic
1146878135 17:36429063-36429085 GCCGATCTCACCCGCTCCGCAGG + Exonic
1146882085 17:36450210-36450232 GCCGATCTCACCCGCTCCGCAGG + Intergenic
1147068613 17:37934898-37934920 GCCGATCTCACCCGCTCCGCAGG - Exonic
1147073661 17:37978606-37978628 GCCGATCTCACCCGCTCCGCAGG + Intronic
1147080135 17:38014435-38014457 GCCGATCTCACCCGCTCCGCAGG - Intronic
1147085182 17:38058144-38058166 GCCGATCTCACCCGCTCCGCAGG + Exonic
1147096084 17:38138395-38138417 GCCGATCTCACCCGCTCCGCAGG - Intergenic
1147101128 17:38182110-38182132 GCCGATCTCACCCGCTCCGCAGG + Intergenic
1149491976 17:57091565-57091587 CCCCAGCTCCCCAGCTCCCCGGG - Intronic
1149845727 17:60008616-60008638 GCCGATCTCACCCGCTCCGCAGG + Intergenic
1150084075 17:62265196-62265218 GCCGATCTCACCCGCTCCGCAGG + Intergenic
1150636879 17:66919199-66919221 CCCGAGCACTGCTGCTCCGCCGG - Intergenic
1150772160 17:68051372-68051394 CCTGAGCTCAGGCGATCCGCCGG + Intergenic
1151866427 17:76806250-76806272 CCCCGGCCCCGCCGCCCCGCCGG + Intergenic
1152245558 17:79183076-79183098 CCCGCGCTCGGCCGCCGCGCAGG + Intronic
1152429949 17:80243259-80243281 CCCAAGCTCCGCCACTCAACTGG - Intronic
1152467937 17:80476282-80476304 CCGGAGCTCCTCGGCGCCGCCGG + Exonic
1160697361 19:491628-491650 CCCAAGCCCCGCCTCTCCCCTGG + Intronic
1160697570 19:492125-492147 CCCAAGCCCCGCCTCTCCTCTGG + Intronic
1163583023 19:18149434-18149456 CCCGATCCCCGCGGCTGCGCCGG + Exonic
1164888848 19:31805854-31805876 TCCCAGCTCCGCCGCTTCCCGGG + Intergenic
1166294697 19:41883246-41883268 CCCGACCTCGGGCGCCCCGCCGG + Intronic
1167516545 19:49926605-49926627 CCCTATCTCCCCCGCCCCGCCGG - Intronic
1167596676 19:50432001-50432023 CCCAAGCCCCGCCCCTCCCCAGG + Intergenic
925725370 2:6865954-6865976 CCCCAGGTGCGCGGCTCCGCGGG + Intronic
927606570 2:24491511-24491533 CCCGGCCTCCGCCGCTCCTCGGG - Intergenic
927772868 2:25878622-25878644 TCCGGTCTCCGCCTCTCCGCAGG + Intergenic
932231373 2:70086967-70086989 CCCGCGCGCACCCGCTCCGCAGG + Intergenic
933684734 2:85133761-85133783 CCCGAGGTCGTCCCCTCCGCCGG - Exonic
935895552 2:107733757-107733779 CCAGAGCTCCCCCTCTCCACAGG + Intergenic
948603796 2:239122207-239122229 CCCGAGGCCCTCCGCTCTGCAGG + Intronic
948945899 2:241218501-241218523 CCCCAGCTCCCCCCCTCCCCCGG - Intronic
949004531 2:241637668-241637690 CCCGAGCGGCGTCGCTCCGACGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1176566811 21:8392261-8392283 ACGGCGCTCCGCCGCCCCGCGGG - Intergenic
1178954005 21:37006982-37007004 GTCGAGCTCCGGAGCTCCGCTGG - Intronic
1179480247 21:41672316-41672338 CCGGAGCTCTGCCGCCCAGCAGG - Intergenic
1181094213 22:20495092-20495114 CCCTCGCTCCGGCCCTCCGCGGG - Intronic
1181696073 22:24593283-24593305 GCCGAGCTCCGCGTCTCCCCTGG - Intronic
1182551851 22:31104945-31104967 TCCCAGCTCCGCCGCGCCCCCGG + Exonic
1183163306 22:36129176-36129198 CCTCAGCTCCGCTGCTCCACTGG + Intergenic
1183702170 22:39457112-39457134 GCCGGGCTCCGCCGCCGCGCCGG - Intergenic
1183831220 22:40419185-40419207 CCCGTGCTCAGCCGGGCCGCTGG + Exonic
1184060783 22:42079744-42079766 CCCCAGCTCCGCCCCTCACCCGG - Exonic
1184236717 22:43187017-43187039 CCCGGGCTGCTACGCTCCGCAGG + Exonic
1184783995 22:46663033-46663055 CCCTGGCTCCGGCGCTCTGCAGG - Exonic
951906960 3:27715435-27715457 CCCCCGCTCCGCCGCGCCCCAGG + Intergenic
952316579 3:32238013-32238035 CCCAGGCTCCACCGGTCCGCGGG + Intergenic
952418968 3:33114387-33114409 CCCGAGCTGCGCCTCTTCGGGGG + Exonic
953761167 3:45688510-45688532 ACCGAGCGCAGCCGCACCGCAGG + Intergenic
956678109 3:71753956-71753978 CCCGAGCTCCGCCGCTCCGCCGG - Intronic
961654348 3:128433093-128433115 CCCGAGCTCCGCCCGCCCGCAGG - Intergenic
962259973 3:133895913-133895935 CCCCAGCCCCGCAGCCCCGCGGG - Intergenic
965060962 3:163785869-163785891 CCAGAGCTCAGCAGCTCCACTGG - Intergenic
965728611 3:171746153-171746175 CCCGAGCCCCTCCCCTCCGCGGG + Intronic
968133665 3:196207572-196207594 CCCGAGCCCCGCCCCGCCCCCGG + Intronic
968133688 3:196207622-196207644 CCCGAGCCCCGCCCCGCCCCTGG + Intronic
968133712 3:196207669-196207691 CCCGAGCCCCGCCCCGCCCCCGG + Intronic
968133735 3:196207719-196207741 CCCGAGCCCCGCCCCGCCCCTGG + Intronic
968392528 4:205196-205218 CCCGAGCTGCGGAGCCCCGCAGG - Intergenic
968514719 4:1011367-1011389 CCCGAGCCTCGCCGCGCCCCCGG - Intronic
968598252 4:1496328-1496350 CCCCAGCTCCACCCCACCGCAGG + Intergenic
979349219 4:119627086-119627108 CCCGAGACCCGCCGCGCCCCCGG + Intronic
980027191 4:127781697-127781719 CCCGGGCTCGGCAGCTCCCCCGG + Intergenic
985472406 5:54025-54047 CCGGAGATCCGCTGCTCCCCGGG + Intergenic
998406772 5:141878538-141878560 CCCGAGCTCCACCTCCCGGCCGG - Intronic
1005303799 6:24495120-24495142 GCCCAGCTCCGCTGCTACGCTGG + Exonic
1010757462 6:79683043-79683065 CCCCAGCTCCCCCGCTCGACAGG - Intronic
1011734279 6:90296437-90296459 CCCGGGCCCCGCCGCTGGGCGGG - Intronic
1016863780 6:148747130-148747152 CCCGCGCCCCGCCGCGCCTCGGG - Intergenic
1019276195 7:177274-177296 CCCGAGCTCCTTCCCTCCCCAGG + Intergenic
1027361508 7:77415569-77415591 CCCGAGCTCCGCACCTGTGCAGG - Intronic
1029098322 7:98106902-98106924 TCCCAGGCCCGCCGCTCCGCAGG + Exonic
1029390722 7:100272163-100272185 CCCGCGCGCCGCTGCTCCGCCGG - Exonic
1029640515 7:101816685-101816707 CCCCAGCTCCGCCGCGCCGGCGG - Intronic
1040038751 8:42896421-42896443 CCCGCCGTCCGCGGCTCCGCGGG + Exonic
1049693609 8:143973288-143973310 CCCGAGCGCGGCCACTCCGCCGG - Intronic
1051929024 9:22363567-22363589 CCCGAGCCTCCCCGCTCCCCGGG - Intergenic
1053137048 9:35657836-35657858 CCCGCGCCACGCCGCTCAGCGGG + Intergenic
1057298050 9:93860827-93860849 CCGTAGCGCCGCCGCTCCCCGGG - Intergenic
1060101311 9:120843178-120843200 CCCCACCCTCGCCGCTCCGCTGG - Intergenic
1061148902 9:128817879-128817901 CCCGACCTCAGGCGATCCGCCGG - Intergenic
1061609938 9:131739703-131739725 CTGGGGCTCCGCCGCTCCCCGGG - Intronic
1062435849 9:136546223-136546245 CCCGACCCACGCCGCGCCGCCGG - Intergenic
1062442583 9:136577592-136577614 TCCGAGCCCCGCAGCTCCTCCGG - Intergenic
1189331255 X:40146234-40146256 CCCCGGCTCCGCGCCTCCGCGGG - Intronic
1196740578 X:119021794-119021816 CAGGAGCTCCGCCGCTCCAATGG - Intergenic
1196918263 X:120561168-120561190 CGCGAGCTCCCCCGCCCCCCGGG - Intronic