ID: 956687811

View in Genome Browser
Species Human (GRCh38)
Location 3:71847400-71847422
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956687811_956687816 -8 Left 956687811 3:71847400-71847422 CCCTCCATCTCCTGCAAATGATA No data
Right 956687816 3:71847415-71847437 AAATGATAGGTTAGATCTAAAGG No data
956687811_956687817 0 Left 956687811 3:71847400-71847422 CCCTCCATCTCCTGCAAATGATA No data
Right 956687817 3:71847423-71847445 GGTTAGATCTAAAGGACTGATGG No data
956687811_956687818 21 Left 956687811 3:71847400-71847422 CCCTCCATCTCCTGCAAATGATA No data
Right 956687818 3:71847444-71847466 GGATTCAAGACAAGCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956687811 Original CRISPR TATCATTTGCAGGAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr