ID: 956688104

View in Genome Browser
Species Human (GRCh38)
Location 3:71850822-71850844
Sequence TTGGGAGATTTGCAGTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956688100_956688104 -4 Left 956688100 3:71850803-71850825 CCTCTCCTGTGTTTGGTCATTGG No data
Right 956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG No data
956688103_956688104 -9 Left 956688103 3:71850808-71850830 CCTGTGTTTGGTCATTGGGAGAT No data
Right 956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG No data
956688099_956688104 -3 Left 956688099 3:71850802-71850824 CCCTCTCCTGTGTTTGGTCATTG No data
Right 956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956688104 Original CRISPR TTGGGAGATTTGCAGTTTGT AGG Intergenic
No off target data available for this crispr