ID: 956689248

View in Genome Browser
Species Human (GRCh38)
Location 3:71860898-71860920
Sequence GTTTATATGGGGAATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956689248_956689254 0 Left 956689248 3:71860898-71860920 CCTGCCACATTCCCCATATAAAC No data
Right 956689254 3:71860921-71860943 CATAAACCCCCAGCTCCATGAGG No data
956689248_956689259 11 Left 956689248 3:71860898-71860920 CCTGCCACATTCCCCATATAAAC No data
Right 956689259 3:71860932-71860954 AGCTCCATGAGGAGACAAACAGG No data
956689248_956689261 26 Left 956689248 3:71860898-71860920 CCTGCCACATTCCCCATATAAAC No data
Right 956689261 3:71860947-71860969 CAAACAGGAGAACAGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956689248 Original CRISPR GTTTATATGGGGAATGTGGC AGG (reversed) Intergenic
No off target data available for this crispr