ID: 956689627

View in Genome Browser
Species Human (GRCh38)
Location 3:71863860-71863882
Sequence CAGGGTCATCAGAAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956689608_956689627 27 Left 956689608 3:71863810-71863832 CCCAAGAGGAGTGGATACCCCGC No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689620_956689627 3 Left 956689620 3:71863834-71863856 CCACAGGGAGCCACATGGGGAAG No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689612_956689627 10 Left 956689612 3:71863827-71863849 CCCCGCCCCACAGGGAGCCACAT No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689618_956689627 5 Left 956689618 3:71863832-71863854 CCCCACAGGGAGCCACATGGGGA No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689609_956689627 26 Left 956689609 3:71863811-71863833 CCAAGAGGAGTGGATACCCCGCC No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689613_956689627 9 Left 956689613 3:71863828-71863850 CCCGCCCCACAGGGAGCCACATG No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689619_956689627 4 Left 956689619 3:71863833-71863855 CCCACAGGGAGCCACATGGGGAA No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689607_956689627 28 Left 956689607 3:71863809-71863831 CCCCAAGAGGAGTGGATACCCCG No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689623_956689627 -7 Left 956689623 3:71863844-71863866 CCACATGGGGAAGCACCAGGGTC 0: 8
1: 17
2: 62
3: 111
4: 254
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data
956689614_956689627 8 Left 956689614 3:71863829-71863851 CCGCCCCACAGGGAGCCACATGG No data
Right 956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956689627 Original CRISPR CAGGGTCATCAGAAGGCAGA GGG Intergenic
No off target data available for this crispr