ID: 956694121

View in Genome Browser
Species Human (GRCh38)
Location 3:71904234-71904256
Sequence GGACTGGGGTGTGCTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956694117_956694121 -3 Left 956694117 3:71904214-71904236 CCGTGTGAGGACAGAGGTGGGGA No data
Right 956694121 3:71904234-71904256 GGACTGGGGTGTGCTGCCACAGG No data
956694108_956694121 29 Left 956694108 3:71904182-71904204 CCAAACGAAGACACACAGACACA No data
Right 956694121 3:71904234-71904256 GGACTGGGGTGTGCTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956694121 Original CRISPR GGACTGGGGTGTGCTGCCAC AGG Intergenic
No off target data available for this crispr