ID: 956697089

View in Genome Browser
Species Human (GRCh38)
Location 3:71927810-71927832
Sequence TTGGAGAAGCAAAGTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956697089_956697093 -3 Left 956697089 3:71927810-71927832 CCATCTTCACTTTGCTTCTCCAA No data
Right 956697093 3:71927830-71927852 CAAGTCCCTCTTTGGGCTTGTGG No data
956697089_956697094 -2 Left 956697089 3:71927810-71927832 CCATCTTCACTTTGCTTCTCCAA No data
Right 956697094 3:71927831-71927853 AAGTCCCTCTTTGGGCTTGTGGG No data
956697089_956697091 -10 Left 956697089 3:71927810-71927832 CCATCTTCACTTTGCTTCTCCAA No data
Right 956697091 3:71927823-71927845 GCTTCTCCAAGTCCCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956697089 Original CRISPR TTGGAGAAGCAAAGTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr