ID: 956697869

View in Genome Browser
Species Human (GRCh38)
Location 3:71933988-71934010
Sequence CTATAATTGGTGGTGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956697869_956697876 6 Left 956697869 3:71933988-71934010 CCAAGAAACACCACCAATTATAG No data
Right 956697876 3:71934017-71934039 GGAGCTAGGAAGAGAGGAAGTGG No data
956697869_956697874 0 Left 956697869 3:71933988-71934010 CCAAGAAACACCACCAATTATAG No data
Right 956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG No data
956697869_956697873 -8 Left 956697869 3:71933988-71934010 CCAAGAAACACCACCAATTATAG No data
Right 956697873 3:71934003-71934025 AATTATAGCAACCAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956697869 Original CRISPR CTATAATTGGTGGTGTTTCT TGG (reversed) Intergenic
No off target data available for this crispr