ID: 956697871

View in Genome Browser
Species Human (GRCh38)
Location 3:71933998-71934020
Sequence CTCCTGGTTGCTATAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956697871_956697874 -10 Left 956697871 3:71933998-71934020 CCACCAATTATAGCAACCAGGAG No data
Right 956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG No data
956697871_956697876 -4 Left 956697871 3:71933998-71934020 CCACCAATTATAGCAACCAGGAG No data
Right 956697876 3:71934017-71934039 GGAGCTAGGAAGAGAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956697871 Original CRISPR CTCCTGGTTGCTATAATTGG TGG (reversed) Intergenic