ID: 956697874

View in Genome Browser
Species Human (GRCh38)
Location 3:71934011-71934033
Sequence CAACCAGGAGCTAGGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956697871_956697874 -10 Left 956697871 3:71933998-71934020 CCACCAATTATAGCAACCAGGAG No data
Right 956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG No data
956697869_956697874 0 Left 956697869 3:71933988-71934010 CCAAGAAACACCACCAATTATAG No data
Right 956697874 3:71934011-71934033 CAACCAGGAGCTAGGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956697874 Original CRISPR CAACCAGGAGCTAGGAAGAG AGG Intergenic
No off target data available for this crispr