ID: 956697876

View in Genome Browser
Species Human (GRCh38)
Location 3:71934017-71934039
Sequence GGAGCTAGGAAGAGAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956697871_956697876 -4 Left 956697871 3:71933998-71934020 CCACCAATTATAGCAACCAGGAG No data
Right 956697876 3:71934017-71934039 GGAGCTAGGAAGAGAGGAAGTGG No data
956697872_956697876 -7 Left 956697872 3:71934001-71934023 CCAATTATAGCAACCAGGAGCTA No data
Right 956697876 3:71934017-71934039 GGAGCTAGGAAGAGAGGAAGTGG No data
956697869_956697876 6 Left 956697869 3:71933988-71934010 CCAAGAAACACCACCAATTATAG No data
Right 956697876 3:71934017-71934039 GGAGCTAGGAAGAGAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956697876 Original CRISPR GGAGCTAGGAAGAGAGGAAG TGG Intergenic