ID: 956697890 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:71934152-71934174 |
| Sequence | CTGAATATACAAATAGACCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956697887_956697890 | 18 | Left | 956697887 | 3:71934111-71934133 | CCACTCAATTTGTGAGACTTTGT | No data | ||
| Right | 956697890 | 3:71934152-71934174 | CTGAATATACAAATAGACCATGG | No data | ||||
| 956697886_956697890 | 26 | Left | 956697886 | 3:71934103-71934125 | CCTTTAGGCCACTCAATTTGTGA | No data | ||
| Right | 956697890 | 3:71934152-71934174 | CTGAATATACAAATAGACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956697890 | Original CRISPR | CTGAATATACAAATAGACCA TGG | Intergenic | ||
| No off target data available for this crispr | |||||