ID: 956697890

View in Genome Browser
Species Human (GRCh38)
Location 3:71934152-71934174
Sequence CTGAATATACAAATAGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956697887_956697890 18 Left 956697887 3:71934111-71934133 CCACTCAATTTGTGAGACTTTGT No data
Right 956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG No data
956697886_956697890 26 Left 956697886 3:71934103-71934125 CCTTTAGGCCACTCAATTTGTGA No data
Right 956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956697890 Original CRISPR CTGAATATACAAATAGACCA TGG Intergenic
No off target data available for this crispr