ID: 956706782

View in Genome Browser
Species Human (GRCh38)
Location 3:72005931-72005953
Sequence GTAGACTAGTTCACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956706776_956706782 11 Left 956706776 3:72005897-72005919 CCTCCTGTTAACCTGTCTTATGC No data
Right 956706782 3:72005931-72005953 GTAGACTAGTTCACTGAGGAGGG No data
956706778_956706782 0 Left 956706778 3:72005908-72005930 CCTGTCTTATGCCAATTTAATTT No data
Right 956706782 3:72005931-72005953 GTAGACTAGTTCACTGAGGAGGG No data
956706777_956706782 8 Left 956706777 3:72005900-72005922 CCTGTTAACCTGTCTTATGCCAA No data
Right 956706782 3:72005931-72005953 GTAGACTAGTTCACTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956706782 Original CRISPR GTAGACTAGTTCACTGAGGA GGG Intergenic
No off target data available for this crispr