ID: 956710624

View in Genome Browser
Species Human (GRCh38)
Location 3:72035613-72035635
Sequence CTGATTGCACAGATGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956710624_956710629 20 Left 956710624 3:72035613-72035635 CCTTCCTTCATCTGTGCAATCAG 0: 1
1: 0
2: 1
3: 30
4: 280
Right 956710629 3:72035656-72035678 TTTGTTCAGATACTTAGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956710624 Original CRISPR CTGATTGCACAGATGAAGGA AGG (reversed) Intergenic
900896409 1:5485986-5486008 CTGACTGGACAGATGAGGGCTGG - Intergenic
900896422 1:5486100-5486122 CTGCTTGGACAGGTGAAGGCTGG - Intergenic
900896429 1:5486138-5486160 CTGACTGCACAGGTGAGGGTTGG - Intergenic
901116212 1:6846982-6847004 CTGCTTGAGCACATGAAGGATGG + Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
904885777 1:33737239-33737261 CTGATTGCACTGAGGAAGAATGG + Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
912528301 1:110301670-110301692 CCCATTGAACAGATGAGGGAAGG - Intergenic
912699910 1:111869706-111869728 CTGCTTTCACAGATGAGGAAGGG + Intronic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
915461151 1:156071273-156071295 CTGATCCCAAAGAAGAAGGATGG + Intergenic
917371463 1:174298294-174298316 CTGCTTGCACTCATGAAGCAGGG + Intronic
917654409 1:177112091-177112113 CAGATTGCACATATAGAGGAGGG - Intronic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920320854 1:205121390-205121412 CTCATTGAACAGATGAATAAAGG - Intronic
920501436 1:206487854-206487876 CTAATAGCACAGAGGAAAGAGGG - Intronic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
921200097 1:212796394-212796416 CTGATTGTATTGATGAAGCATGG + Intronic
921431476 1:215070756-215070778 CTAATAGGACAGCTGAAGGAAGG - Intronic
921803336 1:219426918-219426940 CTTATTTCACAAATGAAGAAAGG + Intergenic
922790877 1:228310262-228310284 ATGAATGGACAGATGATGGATGG - Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1066299449 10:34083990-34084012 CTGATTGGAGTGATGAAGGATGG + Intergenic
1068665493 10:59671065-59671087 CTGCCTTCACAGATGAGGGAGGG + Intronic
1070419977 10:76226768-76226790 CTGATTCCACTCATGGAGGAAGG - Intronic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1071926466 10:90415459-90415481 CAGCTTGCACACATGAAGCAGGG - Intergenic
1076031731 10:127164817-127164839 CTGACTGCATGAATGAAGGAAGG - Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1077983950 11:7331971-7331993 TTGAGTGCACAGGTGAATGAAGG + Intronic
1078860889 11:15245178-15245200 CTGGTTGCACAGGGGAGGGAGGG + Intronic
1079506883 11:21162995-21163017 ATGATTGCACTGAGAAAGGAGGG + Intronic
1080868979 11:36220416-36220438 TTGATTCCCCAGATGAGGGAGGG - Intronic
1081100463 11:38995478-38995500 CAGATTTCTCAGAAGAAGGAAGG - Intergenic
1081503661 11:43692457-43692479 CTGATACCACAGATGAAGAAAGG - Intronic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1084461892 11:69300847-69300869 ATGAATGCACGGATGATGGATGG + Intronic
1084543744 11:69803353-69803375 CAGATTGCAGGGCTGAAGGAAGG - Intergenic
1084911022 11:72389312-72389334 CTGATGGCACAGAGGAAGGTAGG + Intronic
1086439744 11:86816192-86816214 CTAATTGAAGAGATGGAGGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092078264 12:5691425-5691447 CAAATTCCACAGATGAAGGCAGG + Intronic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092657669 12:10704120-10704142 GAGATTGGAGAGATGAAGGATGG - Exonic
1093714006 12:22360960-22360982 CTGACAGCACAGGGGAAGGAAGG + Intronic
1093855039 12:24091908-24091930 CTAATTGCAGAGATCAAGTAAGG - Intergenic
1093996021 12:25643722-25643744 CTGATGGCAAAGAAGAAGGGAGG + Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1095237214 12:39812176-39812198 GTGAGGGCACAGATGAAAGATGG - Intronic
1096431373 12:51546312-51546334 CTGATTCCAGAGCTGAAGCAGGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1098463685 12:70762945-70762967 CTGTTTGCAAGGGTGAAGGAGGG - Intronic
1098869870 12:75804743-75804765 CTGTTTGATCAGATGAAGTATGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100040663 12:90313340-90313362 CTGAATGCACACATTAAAGAAGG + Intergenic
1100179445 12:92069603-92069625 CTGGTTGAACAAATGAGGGATGG - Intronic
1102628998 12:114260440-114260462 CTGATTGAATAAATGAATGAAGG + Intergenic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104132768 12:125910299-125910321 CCTATTGCACAGATGATGGCAGG - Intergenic
1104222081 12:126794879-126794901 CTTATTGAACAGATGATGGATGG - Intergenic
1104588846 12:130068477-130068499 CTGGTTGTACAGATGCAGGCAGG - Intergenic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1107681826 13:42859718-42859740 ATCATTACACAGATGCAGGAAGG - Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1109637214 13:65137329-65137351 TTTATTGCACACATGAATGAGGG + Intergenic
1109781614 13:67117711-67117733 CCAATTTCACAGATAAAGGAGGG + Intronic
1111407577 13:87829255-87829277 CTGATTGCACAAATGGTGTATGG + Intergenic
1112299886 13:98220199-98220221 CTGATTGTACTGATAATGGAAGG + Intronic
1112745184 13:102519829-102519851 CTGCTTGCAGAGAAGAGGGAGGG - Intergenic
1113130449 13:107030945-107030967 ATGATTGAATAAATGAAGGAAGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113728475 13:112623291-112623313 ATGATGGCACAGATGATGGCAGG - Intergenic
1114880579 14:26780506-26780528 CTGATTTTGCAGATGAAAGAAGG - Intergenic
1115463937 14:33693115-33693137 GTGAATGAACAGTTGAAGGATGG - Intronic
1115465920 14:33714015-33714037 CTGATTACAGACTTGAAGGAAGG - Intronic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1117814445 14:59582622-59582644 CCCATTGTACAGATGAAGAATGG - Intergenic
1119852536 14:77876262-77876284 CTGGCTGTAAAGATGAAGGAAGG - Intronic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1122484439 14:102069183-102069205 CTGAGTGCAGAGATGTAGTAGGG + Intergenic
1122497621 14:102170470-102170492 CTAATTTGACAGATGAAAGATGG + Intronic
1122748055 14:103911380-103911402 CTGATTGCACTGCTGTAGGAAGG - Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1123785020 15:23662976-23662998 CCCAGTGGACAGATGAAGGAAGG + Intergenic
1124414671 15:29465208-29465230 CTGCTTGCACATTTGAAGGCTGG - Intronic
1125318082 15:38454043-38454065 CTGAGAGCACAGCTGAAGAAGGG - Intergenic
1125726142 15:41869138-41869160 CTCATTGCATGGAGGAAGGAAGG + Intronic
1126796502 15:52264229-52264251 CACATTGCCCAGATGTAGGATGG + Exonic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127850309 15:62906516-62906538 CCAATTGCACAGGAGAAGGAAGG - Intergenic
1128576051 15:68775919-68775941 ATGGTTGCACAGATGAGGGTAGG - Intergenic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129771842 15:78207820-78207842 CTGATGGCAGCCATGAAGGAAGG + Intronic
1130538892 15:84807234-84807256 TTCATTGCACTGATGAAGTAGGG - Intergenic
1131079340 15:89521750-89521772 CTAATTGCAGGGAGGAAGGAGGG - Intergenic
1131699374 15:94917606-94917628 CTGATTGCACAGCTCAAGTGTGG - Intergenic
1131874689 15:96792273-96792295 CTGAGAGCACTGATGAGGGAGGG + Intergenic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1134136594 16:11680462-11680484 CTGAGAGCACAGAATAAGGAAGG + Intronic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138006185 16:53340055-53340077 GTGAGTGCACAGAGGAAGAAAGG - Intergenic
1138194076 16:55039853-55039875 CTGATTCCACAGATGTAGAGGGG - Intergenic
1139108614 16:63861097-63861119 CTGATTGCACTATTGATGGAGGG + Intergenic
1139401301 16:66683970-66683992 CTGAGTGCAAAGACGAAGGCAGG + Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141881885 16:86865722-86865744 CTAATTCCACAGATGAGGAAAGG - Intergenic
1142039308 16:87882353-87882375 CTGATTGCACAAATCAGAGAAGG + Exonic
1144305583 17:13966770-13966792 CGGCTTGCACCGATGAAGCAGGG + Intergenic
1144597181 17:16580523-16580545 CTGATTTCACAAATGGCGGAGGG + Intergenic
1144745136 17:17609060-17609082 GTGCTTGCAGAGATGAAGAAGGG + Intergenic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1147884660 17:43676521-43676543 CTGATTCCCAAGAAGAAGGAAGG - Intergenic
1149154878 17:53616159-53616181 CTGATTCTACAGAAGTAGGATGG + Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156503953 18:37577407-37577429 CGGATGGCACAGAAGAAGGAAGG - Intergenic
1157401483 18:47392210-47392232 CTGATTGCACAGAAGAGAAAAGG - Intergenic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159758851 18:72399402-72399424 CTGATTTCACAGCTACAGGAGGG + Intergenic
1159888101 18:73928538-73928560 CTGATTCCATAAAGGAAGGAAGG + Intergenic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1161058587 19:2202758-2202780 CGGTTTGCAAACATGAAGGAAGG + Exonic
1161336195 19:3714943-3714965 CTGAATGCACAGAAGAATTAAGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162441572 19:10695555-10695577 TTGATTGCGCAAAGGAAGGAAGG - Intergenic
1164566154 19:29327453-29327475 CTGAGTGCCCACATGAAGGGTGG - Intergenic
1164816897 19:31211322-31211344 CAGGTTGCAGAGATGAGGGAGGG + Intergenic
1166685616 19:44794337-44794359 CTGAGTGCACAGGTGAACCAGGG - Intronic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
925591621 2:5515533-5515555 CTGATTTCAGAGATGTAAGATGG + Intergenic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926776988 2:16432564-16432586 CACATGGCACAGAGGAAGGATGG + Intergenic
927278851 2:21286168-21286190 CTGGTTCCACAGATGACAGAGGG + Intergenic
927422682 2:22949467-22949489 ATGACTTGACAGATGAAGGAAGG + Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928022252 2:27714442-27714464 CCCATTGCACAGATGAAGTTGGG + Intronic
928791480 2:34960781-34960803 CTGTTTGCAGAGATGAAGTCTGG - Intergenic
930114383 2:47706415-47706437 CTGATTGCACAGAGCATGGATGG - Intronic
931274751 2:60734628-60734650 CTGATTCCAAACATGTAGGATGG - Intergenic
931630172 2:64291342-64291364 CTGACTGCAGTGATGAAGAAAGG + Intergenic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
933989927 2:87626874-87626896 TTGGTTTCACAGGTGAAGGAAGG - Intergenic
936303918 2:111323950-111323972 TTGGTTTCACAGGTGAAGGAAGG + Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
937324786 2:120984077-120984099 CTGATTTCTCTGATGAAGAAAGG - Intronic
937430448 2:121833487-121833509 TTCATTGCACAGATGAGGCACGG + Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
942368865 2:175259074-175259096 CTGAGTGCACAGACCAGGGAGGG - Intergenic
942833633 2:180266038-180266060 CTGATTTCTAAGAAGAAGGAGGG + Intergenic
943705008 2:191025336-191025358 CTGATTCCACTTATGGAGGAAGG - Intergenic
943887468 2:193239959-193239981 ATGATTGAACAGATCAATGAGGG - Intergenic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
1171414151 20:24966127-24966149 CCGATTGCAGAGCTGAAGCAGGG + Intronic
1172514522 20:35523682-35523704 CTGAATGCCAAGGTGAAGGAGGG - Intronic
1174048450 20:47750380-47750402 CTGATGGAACTGATGAGGGATGG - Intronic
1174752386 20:53124268-53124290 CTGATTGCAGACATGCAGGGGGG - Intronic
1175165308 20:57039329-57039351 ATGATTGGATAGATGATGGATGG + Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177567496 21:22843894-22843916 CAGGTTCCAGAGATGAAGGAGGG + Intergenic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1179201164 21:39222414-39222436 CTGATTCCACAGCTGAGGTAAGG + Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180067622 21:45420527-45420549 CTGACAGCAGGGATGAAGGAGGG - Intronic
1180750496 22:18121199-18121221 GTGGTTGCAAAGATGAAGCAAGG - Intronic
1181505277 22:23351898-23351920 CTGATTGCATAGGTGCATGATGG + Intergenic
1182579421 22:31296166-31296188 CTGATTGCCTTGAGGAAGGAAGG - Intergenic
1183198244 22:36368146-36368168 CCCATTGTACAGATGAAGAAAGG - Intronic
1183989756 22:41589915-41589937 CTGATTGGCCAAATGAAGAAGGG + Intergenic
1184669793 22:46006675-46006697 CTGCGTGCACAGATGAGGGCCGG - Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
950339229 3:12227842-12227864 CTGATACCACAGATGAAGCCCGG + Intergenic
950526645 3:13528350-13528372 CTGAAGGCACAGCTGAAGTAGGG + Intergenic
950554650 3:13688101-13688123 CCTATTCCACAGATGAAGAAGGG + Intergenic
953248011 3:41214131-41214153 CTGATGGCACACATGAAGTTTGG + Intronic
954538591 3:51379438-51379460 CTGCTGGCACAGCTGAAGGGTGG - Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955467249 3:59250194-59250216 CTGCTGGCACAGAGGAAGGAGGG + Intergenic
956688777 3:71856928-71856950 CTGATTATGCAGATGATGGAAGG - Intergenic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
958816457 3:98921688-98921710 CTTATTTCACAGATGAGGAATGG + Intergenic
961909550 3:130300880-130300902 ATGATTGGAGAGATGAAAGACGG + Intergenic
962125896 3:132617401-132617423 CAAATTGAAAAGATGAAGGAAGG - Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
963138103 3:141925941-141925963 CTGATTCCAAACATGTAGGATGG + Exonic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964032112 3:152150780-152150802 CAGATTGCAAGGAGGAAGGAAGG - Intergenic
966378996 3:179324551-179324573 ATGATTGCTAAAATGAAGGATGG + Intronic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
972131232 4:35836491-35836513 CTGATAGTACAGATTAAGGCAGG + Intergenic
972556696 4:40188842-40188864 CTGATTACAAAGATCAAGGGAGG + Intergenic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
972874466 4:43341376-43341398 CTGATTTAACAGATCAAAGAAGG - Intergenic
975332090 4:73128001-73128023 CTGACTGCAGAGATCAGGGATGG + Intronic
977749611 4:100593502-100593524 TTGATTTCACAGATGAAGTATGG - Intronic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
978918482 4:114152797-114152819 CTGCTTCTACAGATGAAGTAAGG - Intergenic
980852121 4:138395824-138395846 GTGATTCCACAGAAGAAGAAAGG + Intergenic
981049812 4:140298647-140298669 CTGATTGGCCACAGGAAGGAAGG - Intronic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
982833816 4:160097290-160097312 ATGATTTCACAGCTGAAAGAAGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985099513 4:186444489-186444511 CTGAGTGGACAGCTGTAGGAGGG + Intronic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986073650 5:4312465-4312487 CTGTTTGCACAGTGAAAGGAAGG - Intergenic
987384779 5:17318832-17318854 ATGATTACTGAGATGAAGGAAGG + Intergenic
988147137 5:27324243-27324265 CTCATTGTACAGATGAATGGGGG + Intergenic
988602395 5:32652000-32652022 TTCATTTCACAGATGAAAGAGGG - Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992747538 5:79834420-79834442 CTGTCTGCGCAGATGAGGGAGGG - Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
993556926 5:89351323-89351345 CTGATTGCAGAAATCAAGAAAGG - Intergenic
995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG + Exonic
996022572 5:118607729-118607751 CTAGTTGTACAGAAGAAGGAAGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
997626403 5:135334094-135334116 CCCGTTCCACAGATGAAGGAGGG - Exonic
998705064 5:144749860-144749882 ATGATTGGAGAGATGATGGAGGG + Intergenic
998841838 5:146262472-146262494 TTGATTGAATAGATGAAGGAAGG + Intronic
999668476 5:153937251-153937273 CAGGTCGCACAAATGAAGGATGG + Intergenic
1000684064 5:164224949-164224971 CTGATTGGAGAGATGCAGAAAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1002937810 6:1688325-1688347 CCCATTACACAGATGAACGACGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1007008724 6:38394051-38394073 CTGGTTGGAAAAATGAAGGAAGG - Intronic
1007395688 6:41576341-41576363 CTGTTTGCACTGATGATGAACGG + Intronic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1014909415 6:127072366-127072388 CTTAATGCACACATGAAAGAAGG + Intergenic
1014955625 6:127611674-127611696 GTTATGGCACAGATGATGGATGG + Intergenic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1016089306 6:139956411-139956433 CTGATTGCAAAGGTGCAGTAGGG + Intergenic
1016690066 6:146927589-146927611 CTGGTTGAACAAATGAATGAAGG - Intergenic
1019110570 6:169707992-169708014 TGGATTGCACAGTTGAGGGAGGG + Intronic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1023329130 7:39095203-39095225 CTGATTCCTAAGATGAAGGCAGG + Intronic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024945033 7:54799794-54799816 CTGCTAGCACAGATGAGGGGTGG - Intergenic
1028261499 7:88672363-88672385 CTGATAATAGAGATGAAGGAGGG + Intergenic
1029575496 7:101400870-101400892 CTGAATGAACAAGTGAAGGAAGG - Intronic
1032255438 7:130293414-130293436 CTGATTTCACAGATGAAATGGGG - Intronic
1032433211 7:131879854-131879876 GTGATCCCCCAGATGAAGGATGG + Intergenic
1032731309 7:134646158-134646180 CTTATTGCACAGAGGAAGGGAGG - Intergenic
1032965347 7:137091188-137091210 TTGCTTCCACAGTTGAAGGAAGG + Intergenic
1033828426 7:145221403-145221425 CTGGTATCACAAATGAAGGAAGG - Intergenic
1034464576 7:151219059-151219081 CAGATTGCACACATGAAGGTAGG - Exonic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034762300 7:153684366-153684388 CTTATTTTACAGATGAAGGCAGG + Intergenic
1034865277 7:154636385-154636407 CTGCTTGCCCAGGAGAAGGAAGG - Intronic
1037500507 8:19481148-19481170 GTGACTGGAAAGATGAAGGATGG - Intronic
1037729118 8:21508502-21508524 CTAATAGGAGAGATGAAGGAAGG - Intergenic
1038660810 8:29495078-29495100 CTGATAACACAGTTGAAAGAAGG + Intergenic
1039911183 8:41828315-41828337 CTGCACGCACAGACGAAGGAAGG - Intronic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1044249463 8:89989018-89989040 CTGATTGCCAGGATGAAAGATGG + Intronic
1046740801 8:117827022-117827044 CTGATTTGCCAGATGAAAGATGG - Intronic
1046916293 8:119681452-119681474 GTTATTACACAAATGAAGGAAGG + Intergenic
1047526360 8:125637747-125637769 CTGTTATCACAGCTGAAGGAGGG + Intergenic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1050024684 9:1321434-1321456 CTGAGTGGAAAGATGAAGAATGG - Intergenic
1053323614 9:37121321-37121343 CAGATTGCACAGTTGAATTACGG + Intronic
1055397071 9:75887630-75887652 TTGATTTAACAGATGAATGAGGG + Intergenic
1056584968 9:87921832-87921854 CTGAGTACACAGCTCAAGGAAGG - Intergenic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1059655983 9:116357920-116357942 CTCATTGCACAGATCACAGAAGG + Intronic
1060757426 9:126223584-126223606 CTGCTTTCACAGATGAGGGACGG - Intergenic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061543047 9:131288625-131288647 CTGCTCGCCCAGATGAAGGCAGG - Intergenic
1062172238 9:135141335-135141357 ATGAATGGACAGATGATGGATGG + Intergenic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1186303139 X:8222522-8222544 CTGATTGTCAAGATGAAAGAGGG - Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189401114 X:40669572-40669594 CAGATTTCACAGAGAAAGGAGGG - Intronic
1192154457 X:68733391-68733413 CTGATTGAACAAATGAAGACAGG + Intergenic
1194406797 X:93506331-93506353 CTGATTGCAAAGGTGCAAGAGGG + Intergenic
1194427781 X:93761449-93761471 CTGATTCGATAGATGTAGGATGG + Intergenic
1199538017 X:148925695-148925717 CCCATTACACAGATGAGGGAAGG - Intronic
1200007361 X:153096387-153096409 CAGATTGCACAGAAGTAGGGAGG + Intergenic
1201756405 Y:17491204-17491226 TTCATGGGACAGATGAAGGAAGG + Intergenic
1201845147 Y:18414781-18414803 TTCATGGGACAGATGAAGGAAGG - Intergenic