ID: 956713882

View in Genome Browser
Species Human (GRCh38)
Location 3:72061606-72061628
Sequence CTGTAAGACAAGGATTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956713879_956713882 -9 Left 956713879 3:72061592-72061614 CCTCCAGAAATCATCTGTAAGAC No data
Right 956713882 3:72061606-72061628 CTGTAAGACAAGGATTAGAGTGG No data
956713878_956713882 13 Left 956713878 3:72061570-72061592 CCTAGCTGTGTTAGTTTGGGTTC No data
Right 956713882 3:72061606-72061628 CTGTAAGACAAGGATTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956713882 Original CRISPR CTGTAAGACAAGGATTAGAG TGG Intergenic
No off target data available for this crispr