ID: 956721916

View in Genome Browser
Species Human (GRCh38)
Location 3:72125459-72125481
Sequence CTACATAAACAGGTGGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956721910_956721916 -8 Left 956721910 3:72125444-72125466 CCCATAAAACCTGATCTACATAA No data
Right 956721916 3:72125459-72125481 CTACATAAACAGGTGGGATTTGG No data
956721911_956721916 -9 Left 956721911 3:72125445-72125467 CCATAAAACCTGATCTACATAAA No data
Right 956721916 3:72125459-72125481 CTACATAAACAGGTGGGATTTGG No data
956721909_956721916 18 Left 956721909 3:72125418-72125440 CCATAAGAAGTGGGCATGGCTGT No data
Right 956721916 3:72125459-72125481 CTACATAAACAGGTGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956721916 Original CRISPR CTACATAAACAGGTGGGATT TGG Intergenic
No off target data available for this crispr