ID: 956724425

View in Genome Browser
Species Human (GRCh38)
Location 3:72145492-72145514
Sequence CAGAAGGAAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956724416_956724425 8 Left 956724416 3:72145461-72145483 CCTTTATAAGACAGTGCATTTCT No data
Right 956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG No data
956724415_956724425 25 Left 956724415 3:72145444-72145466 CCAGCAAAGGGCTGCATCCTTTA No data
Right 956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956724425 Original CRISPR CAGAAGGAAGAGAAGGAGGA AGG Intergenic
No off target data available for this crispr