ID: 956725422

View in Genome Browser
Species Human (GRCh38)
Location 3:72152731-72152753
Sequence AGAACCGGTGTCCCAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956725420_956725422 -5 Left 956725420 3:72152713-72152735 CCACAGGGGGTGAAGGGCAGAAC No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725405_956725422 29 Left 956725405 3:72152679-72152701 CCCCAGCCTTCCCTGGAAAATGG No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725411_956725422 19 Left 956725411 3:72152689-72152711 CCCTGGAAAATGGGCTAAACCAA No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725409_956725422 27 Left 956725409 3:72152681-72152703 CCAGCCTTCCCTGGAAAATGGGC No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725407_956725422 28 Left 956725407 3:72152680-72152702 CCCAGCCTTCCCTGGAAAATGGG No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725419_956725422 0 Left 956725419 3:72152708-72152730 CCAATCCACAGGGGGTGAAGGGC No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725410_956725422 23 Left 956725410 3:72152685-72152707 CCTTCCCTGGAAAATGGGCTAAA No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data
956725412_956725422 18 Left 956725412 3:72152690-72152712 CCTGGAAAATGGGCTAAACCAAT No data
Right 956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956725422 Original CRISPR AGAACCGGTGTCCCAGCACC AGG Intergenic
No off target data available for this crispr