ID: 956728599

View in Genome Browser
Species Human (GRCh38)
Location 3:72176987-72177009
Sequence CAGGCAAAGCCAGCAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956728596_956728599 -9 Left 956728596 3:72176973-72176995 CCAGAGAGGACCCTCAGGCAAAG No data
Right 956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG No data
956728593_956728599 16 Left 956728593 3:72176948-72176970 CCAGGGGCTGGGCTGGCTGGGGC No data
Right 956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG No data
956728587_956728599 27 Left 956728587 3:72176937-72176959 CCTGGCTTGTACCAGGGGCTGGG No data
Right 956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956728599 Original CRISPR CAGGCAAAGCCAGCAGTTGT TGG Intergenic
No off target data available for this crispr