ID: 956730646

View in Genome Browser
Species Human (GRCh38)
Location 3:72193732-72193754
Sequence ACTCAGTTACTCAGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956730646_956730654 23 Left 956730646 3:72193732-72193754 CCTGGGTCCCTGAGTAACTGAGT No data
Right 956730654 3:72193778-72193800 CTACCATGCTGACCAGCATTGGG No data
956730646_956730653 22 Left 956730646 3:72193732-72193754 CCTGGGTCCCTGAGTAACTGAGT No data
Right 956730653 3:72193777-72193799 CCTACCATGCTGACCAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956730646 Original CRISPR ACTCAGTTACTCAGGGACCC AGG (reversed) Intergenic
No off target data available for this crispr