ID: 956730648

View in Genome Browser
Species Human (GRCh38)
Location 3:72193739-72193761
Sequence CTGCTCCACTCAGTTACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956730648_956730653 15 Left 956730648 3:72193739-72193761 CCCTGAGTAACTGAGTGGAGCAG No data
Right 956730653 3:72193777-72193799 CCTACCATGCTGACCAGCATTGG No data
956730648_956730654 16 Left 956730648 3:72193739-72193761 CCCTGAGTAACTGAGTGGAGCAG No data
Right 956730654 3:72193778-72193800 CTACCATGCTGACCAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956730648 Original CRISPR CTGCTCCACTCAGTTACTCA GGG (reversed) Intergenic
No off target data available for this crispr