ID: 956730653

View in Genome Browser
Species Human (GRCh38)
Location 3:72193777-72193799
Sequence CCTACCATGCTGACCAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956730646_956730653 22 Left 956730646 3:72193732-72193754 CCTGGGTCCCTGAGTAACTGAGT No data
Right 956730653 3:72193777-72193799 CCTACCATGCTGACCAGCATTGG No data
956730648_956730653 15 Left 956730648 3:72193739-72193761 CCCTGAGTAACTGAGTGGAGCAG No data
Right 956730653 3:72193777-72193799 CCTACCATGCTGACCAGCATTGG No data
956730649_956730653 14 Left 956730649 3:72193740-72193762 CCTGAGTAACTGAGTGGAGCAGA No data
Right 956730653 3:72193777-72193799 CCTACCATGCTGACCAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956730653 Original CRISPR CCTACCATGCTGACCAGCAT TGG Intergenic
No off target data available for this crispr