ID: 956730654

View in Genome Browser
Species Human (GRCh38)
Location 3:72193778-72193800
Sequence CTACCATGCTGACCAGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956730649_956730654 15 Left 956730649 3:72193740-72193762 CCTGAGTAACTGAGTGGAGCAGA No data
Right 956730654 3:72193778-72193800 CTACCATGCTGACCAGCATTGGG No data
956730648_956730654 16 Left 956730648 3:72193739-72193761 CCCTGAGTAACTGAGTGGAGCAG No data
Right 956730654 3:72193778-72193800 CTACCATGCTGACCAGCATTGGG No data
956730646_956730654 23 Left 956730646 3:72193732-72193754 CCTGGGTCCCTGAGTAACTGAGT No data
Right 956730654 3:72193778-72193800 CTACCATGCTGACCAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956730654 Original CRISPR CTACCATGCTGACCAGCATT GGG Intergenic
No off target data available for this crispr