ID: 956731552

View in Genome Browser
Species Human (GRCh38)
Location 3:72201136-72201158
Sequence ACCAGGGAGAAACTAGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956731552_956731558 18 Left 956731552 3:72201136-72201158 CCATACTCTAGTTTCTCCCTGGT No data
Right 956731558 3:72201177-72201199 CTGTAGCACAACCTTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956731552 Original CRISPR ACCAGGGAGAAACTAGAGTA TGG (reversed) Intergenic
No off target data available for this crispr