ID: 956735509

View in Genome Browser
Species Human (GRCh38)
Location 3:72234570-72234592
Sequence GGCTGAGTGTTGCACTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956735509_956735515 14 Left 956735509 3:72234570-72234592 CCTCTGCAGTGCAACACTCAGCC No data
Right 956735515 3:72234607-72234629 AGCAACTGCATGGCCAACAGAGG No data
956735509_956735511 4 Left 956735509 3:72234570-72234592 CCTCTGCAGTGCAACACTCAGCC No data
Right 956735511 3:72234597-72234619 TCCCTCCAGAAGCAACTGCATGG No data
956735509_956735517 29 Left 956735509 3:72234570-72234592 CCTCTGCAGTGCAACACTCAGCC No data
Right 956735517 3:72234622-72234644 AACAGAGGAACCTGACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956735509 Original CRISPR GGCTGAGTGTTGCACTGCAG AGG (reversed) Intergenic
No off target data available for this crispr