ID: 956737619

View in Genome Browser
Species Human (GRCh38)
Location 3:72250195-72250217
Sequence GGGGAGAAGCAGGAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956737615_956737619 -8 Left 956737615 3:72250180-72250202 CCTGTGAAAGAGTATGGGGAGAA No data
Right 956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956737619 Original CRISPR GGGGAGAAGCAGGAGGAGGC TGG Intergenic
No off target data available for this crispr