ID: 956739611

View in Genome Browser
Species Human (GRCh38)
Location 3:72265390-72265412
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956739611_956739615 -9 Left 956739611 3:72265390-72265412 CCTGACATCTACCCTGGGGAGGA No data
Right 956739615 3:72265404-72265426 TGGGGAGGAAGGTTTGACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956739611 Original CRISPR TCCTCCCCAGGGTAGATGTC AGG (reversed) Intergenic