ID: 956739615

View in Genome Browser
Species Human (GRCh38)
Location 3:72265404-72265426
Sequence TGGGGAGGAAGGTTTGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956739606_956739615 -2 Left 956739606 3:72265383-72265405 CCATCAGCCTGACATCTACCCTG No data
Right 956739615 3:72265404-72265426 TGGGGAGGAAGGTTTGACCGAGG No data
956739611_956739615 -9 Left 956739611 3:72265390-72265412 CCTGACATCTACCCTGGGGAGGA No data
Right 956739615 3:72265404-72265426 TGGGGAGGAAGGTTTGACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956739615 Original CRISPR TGGGGAGGAAGGTTTGACCG AGG Intergenic
No off target data available for this crispr