ID: 956743246

View in Genome Browser
Species Human (GRCh38)
Location 3:72291387-72291409
Sequence CGGCTGAGTCAGAGCCAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956743243_956743246 -4 Left 956743243 3:72291368-72291390 CCAGGTGTCCCTACAGGCACGGC No data
Right 956743246 3:72291387-72291409 CGGCTGAGTCAGAGCCAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956743246 Original CRISPR CGGCTGAGTCAGAGCCAACA CGG Intergenic
No off target data available for this crispr