ID: 956745388

View in Genome Browser
Species Human (GRCh38)
Location 3:72307087-72307109
Sequence GGGGCTAGAGCTTTGCAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956745388_956745396 28 Left 956745388 3:72307087-72307109 CCGCTTTGCAAAGCTCTAGCCCC No data
Right 956745396 3:72307138-72307160 CTCCGAGGCCTCCTTCCAAATGG No data
956745388_956745397 29 Left 956745388 3:72307087-72307109 CCGCTTTGCAAAGCTCTAGCCCC No data
Right 956745397 3:72307139-72307161 TCCGAGGCCTCCTTCCAAATGGG No data
956745388_956745394 13 Left 956745388 3:72307087-72307109 CCGCTTTGCAAAGCTCTAGCCCC No data
Right 956745394 3:72307123-72307145 TCCAACAAGTAATTGCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956745388 Original CRISPR GGGGCTAGAGCTTTGCAAAG CGG (reversed) Intergenic
No off target data available for this crispr