ID: 956746200

View in Genome Browser
Species Human (GRCh38)
Location 3:72312687-72312709
Sequence CTGGAGGATGGGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746186_956746200 17 Left 956746186 3:72312647-72312669 CCAGTTTAGAGCTGGAATGGCCT No data
Right 956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG No data
956746192_956746200 -3 Left 956746192 3:72312667-72312689 CCTTGGGAGGTTTTGGAGGCCTG No data
Right 956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746200 Original CRISPR CTGGAGGATGGGAGGGAAGT AGG Intergenic
No off target data available for this crispr