ID: 956746477

View in Genome Browser
Species Human (GRCh38)
Location 3:72314876-72314898
Sequence GTAGGCATGGTAGGGGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746477_956746484 -6 Left 956746477 3:72314876-72314898 CCAACAACCCCTACCATGCCTAC No data
Right 956746484 3:72314893-72314915 GCCTACTCCATGCTGGGCATAGG No data
956746477_956746488 4 Left 956746477 3:72314876-72314898 CCAACAACCCCTACCATGCCTAC No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746477_956746489 17 Left 956746477 3:72314876-72314898 CCAACAACCCCTACCATGCCTAC No data
Right 956746489 3:72314916-72314938 GCTTCAGTGGTGACCAGTCATGG No data
956746477_956746486 -5 Left 956746477 3:72314876-72314898 CCAACAACCCCTACCATGCCTAC No data
Right 956746486 3:72314894-72314916 CCTACTCCATGCTGGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746477 Original CRISPR GTAGGCATGGTAGGGGTTGT TGG (reversed) Intergenic
No off target data available for this crispr