ID: 956746479

View in Genome Browser
Species Human (GRCh38)
Location 3:72314884-72314906
Sequence AGCATGGAGTAGGCATGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746479_956746488 -4 Left 956746479 3:72314884-72314906 CCCTACCATGCCTACTCCATGCT No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746479_956746491 24 Left 956746479 3:72314884-72314906 CCCTACCATGCCTACTCCATGCT No data
Right 956746491 3:72314931-72314953 AGTCATGGCTTCTGCCCTCAAGG No data
956746479_956746489 9 Left 956746479 3:72314884-72314906 CCCTACCATGCCTACTCCATGCT No data
Right 956746489 3:72314916-72314938 GCTTCAGTGGTGACCAGTCATGG No data
956746479_956746492 25 Left 956746479 3:72314884-72314906 CCCTACCATGCCTACTCCATGCT No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746479 Original CRISPR AGCATGGAGTAGGCATGGTA GGG (reversed) Intergenic