ID: 956746483

View in Genome Browser
Species Human (GRCh38)
Location 3:72314889-72314911
Sequence TGCCCAGCATGGAGTAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956746483_956746489 4 Left 956746483 3:72314889-72314911 CCATGCCTACTCCATGCTGGGCA No data
Right 956746489 3:72314916-72314938 GCTTCAGTGGTGACCAGTCATGG No data
956746483_956746491 19 Left 956746483 3:72314889-72314911 CCATGCCTACTCCATGCTGGGCA No data
Right 956746491 3:72314931-72314953 AGTCATGGCTTCTGCCCTCAAGG No data
956746483_956746488 -9 Left 956746483 3:72314889-72314911 CCATGCCTACTCCATGCTGGGCA No data
Right 956746488 3:72314903-72314925 TGCTGGGCATAGGGCTTCAGTGG No data
956746483_956746492 20 Left 956746483 3:72314889-72314911 CCATGCCTACTCCATGCTGGGCA No data
Right 956746492 3:72314932-72314954 GTCATGGCTTCTGCCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956746483 Original CRISPR TGCCCAGCATGGAGTAGGCA TGG (reversed) Intergenic
No off target data available for this crispr